1 / 47

DNA and Protein Synthesis

DNA and Protein Synthesis. Nucleic Acid Review. Name of the molecule identified by the arrow:. Phosphate group Nitrogen base Adenine Sugar. Name given to the circled structure:. Nucleic acid Amino acid Nucleotide Nucleus. The type of reaction responsible for joining molecules A and B.

hallie
Télécharger la présentation

DNA and Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA and Protein Synthesis

  2. Nucleic Acid Review

  3. Name of the molecule identified by the arrow: • Phosphate group • Nitrogen base • Adenine • Sugar

  4. Name given to the circled structure: • Nucleic acid • Amino acid • Nucleotide • Nucleus

  5. The type of reaction responsible for joining molecules A and B • Hydrolysis • Dehydration A B

  6. Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____: • Nucleotide • Codon • Translation • Gene • mRNA

  7. Which is single stranded? • DNA • RNA

  8. Which one can exit the nucleus? • DNA • RNA

  9. The two strands of DNA are bonded together in the middle by their… • Sugars • Phosphates • Nitrogen bases

  10. Which one contains nitrogenous bases A, T, G and C? • DNA • RNA

  11. DNA is … • Single stranded • Double stranded • Triple stranded

  12. Every nucleotide is made up of… • Sugar • Phosphate • Nitrogen base • All of the above

  13. Nucleic Acids - Function • Control the processes of heredity by which cells and organisms reproduce proteins.

  14. Nucleic Acids – Types • DNA • Deoxyribonucleic Acid • RNA • Ribonucleic Acid

  15. Do you remember DNA structure? SUGAR Phosphate

  16. Let’s build on that knowledge…

  17. Protein Synthesis • It’s a process • DNA -> RNA -> Amino Acids (Protein)

  18. RNA • Sugar is Ribose NOT what… • Has nitrogen base Uracil instead of Thymine • Also contains the other 3 bases…what are they? • Only single stranded

  19. RNA

  20. Three processes in this unit… • 1. Replication (DNA DNA) • 2. Transcription (DNA mRNA) • 3. Translation (RNA Protein)

  21. A. DNA Replication • Occurs in the nucleus prior to any cell division • Enzyme is used to “unzip” or “unwind” the DNA • Forms a bubble at the origin site

  22. DNA Replication (cont.) • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA • Nitrogenous bases pair up • A – T • C - G • As a result, you create two identical strands of DNA

  23. Let’s Practice • Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

  24. Let’s Build A Protein

  25. Transcription • 1.) DNA strand unzips • The bonds between the nitrogen bases are broken • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA • 2.) A single strand of mRNA (messenger RNA) is made • Pair up the bases • A • T • C • G The mRNA then travels from nucleus to cytoplasm

  26. Transcription

  27. Where in the cell does transcription take place? • Cytoplasm • Mitochondria • Nucleus • Golgi Body • Vacuole

  28. Any given segment of DNA has directions that make unique what? • Glucose • Proteins • Lipids • Blood cells

  29. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence? • T G A C C A G G T T • A C T G G T C C A A • T G U C C U G G T T • U G A C C A G G U U

  30. Why is mRNA called messenger RNA? • Because it carries the directions to make a protein to the ribosome like a message

  31. Actually 3 types of RNA • mRNA- messenger • Brings message from nucleus to ribosomes in cytoplasm • rRNA- ribosomal • Make up a ribosome • tRNA- transfer • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

  32. The difference between RNA and DNA is what? • The phosphates • The sugars • The nitrogen bases • The way the monomer units bond

  33. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? • Mitochondria • Ribosome • Golgi Body • Lysosome • Nucleus

  34. Translation 1. mRNA meets up with a ribosome…why?? • Ribosomes are the site for protein production 2. tRNAmolecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNAanticodon • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid • Anticodon: 3 Nitrogen base sequence in tRNA

  35. Translation (cont.) • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

  36. That’s the process, Now how do you know what amino acids make up a particular protein • We use an mRNA codon chart

  37. Where in the cell does transcription, the first part of protein synthesis, take place? • Mitochondria • Nucleus • Ribosomes • Cytoplasm

  38. DNA has the directions to make what? • Glucose • Nucleotides • Proteins • Monosaccharides

  39. After a strand of mRNA is made where does it go? • Ribosome • Mitochondria • Lysosome • Vacuole

  40. Where in the cell does translation, the second part of protein synthesis, take place? • Mitochondria • Nucleus • Golgi body • Cytoplasm

  41. Molecules called tRNA’s are floating around the cytoplasm carrying what? • mRNA’s • Glucose • DNA • Nucleotides • Amino Acids

  42. An mRNA codon is made up of how many nitrogen bases? • 1 • 3 • 6 • 24

  43. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? • Phenylalanine • Glutamine • Asparagine • Lysine • Tyrosine

  44. What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C • Threonine – phenylalanine – glutamate – tyrosine • Phenylalanine – leucine – methionine – valine • Tyrosine – glutamate – phenylalanine – threonine • Lysine – cysteine – arginine – histidine

  45. What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G • Isoleucine – alanine – histidine – alanine • Isoleucine – histidine – alanine – isoleucine • Phenylalanine – leucine – valine – arginine • Isoleucine – leucine – threonine – lysine

  46. How would you assess your comprehension of DNA and Protein Synthesis? • A • B • C • D

More Related