Key Concepts in DNA and Protein Synthesis

1. DNA and Protein Synthesis Notes January 4, 2011

2. I. Nucleic Acid Review

3. Name of the molecule identified by the arrow: • Phosphate group • Nitrogen base • Adenine • Sugar

4. Name given to the circled structure: • Nucleic acid • Amino acid • Nucleotide • Nucleus

5. The type of reaction responsible for joining molecules A and B • Hydrolysis • Dehydration A B

6. Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____: • Nucleotide • Codon • Translation • Gene • mRNA

7. Which is single stranded? • DNA • RNA

8. Which one can exit the nucleus? • DNA • RNA

9. The two strands of DNA are bonded together in the middle by their… • Sugars • Phosphates • Nitrogen bases

10. Which one contains nitrogenous bases A, T, G and C? • DNA • RNA

11. A. Function of Nucleic Acids • Control the processes of heredity by which cells and organisms reproduce proteins.

12. B. Types of Nucleic Acids • DNA: Deoxyribonucleic Acid • RNA: Ribonucleic Acid

13. C. Structure of Nucleic Acids • Made up of a chain of Nucleotides that contain • Phosphate backbone • Sugar • Nitrogen base • Guanine • Cytosine • Adenine • Thymine (Found only in DNA) • Uracil (Found only in RNA)

14. DNA SUGAR Phosphate

15. D. DNA vs. RNA • Sugar is Ribose • Has nitrogen base Uracil instead of Thymine • Also contains the other 3 bases • Only single stranded

16. II. Protein Synthesis • It’s a process • DNA -> RNA -> Amino Acids (Protein)

17. Three processes in this unit… • Replication (DNA DNA) • Transcription (DNA mRNA) • Translation (RNA Protein)

18. A. DNA Replication • Occurs in the nucleus prior to any cell division • Enzyme is used to “unzip” or “unwind” the DNA • Forms a bubble at the origin site

19. DNA Replication (cont.) • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA • Nitrogenous bases pair up • A – T • C - G • As a result, you create two identical strands of DNA

20. Let’s Practice • Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

21. B. Transcription • DNA strand unzips • The bonds between the nitrogen bases are broken • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA • A single strand of mRNA (messenger RNA) is made • Pair up the bases • A  U • T  A • C  G • G  C • mRNA then travels from nucleus to cytoplasm

22. Transcription

23. Where in the cell does transcription take place? • Cytoplasm • Mitochondria • Nucleus • Golgi Body • Vacuole

24. Any given segment of DNA has directions that make unique what? • Glucose • Proteins • Lipids • Blood cells

25. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence? • T G A C C A G G T T • A C T G G T C C A A • T G U C C U G G T T • U G A C C A G G U U

26. a. Why is mRNA called messenger RNA? • Because it carries the directions to make a protein to the ribosome like a message

27. 4. Types of RNA • mRNA- messenger • Brings message from nucleus to ribosomes in cytoplasm • rRNA- ribosomal • Make up a ribosome • tRNA- transfer • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

28. The difference between RNA and DNA is what? • The phosphates • The sugars • The nitrogen bases • The way the monomer units bond

29. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? • Mitochondria • Ribosome • Golgi Body • Lysosome • Nucleus

30. C. Translation • mRNA meets up with a ribosome…why?? • Function of ribosome is to be site for protein synthesis • tRNA molecules bring amino acids to ribosomes • An mRNA codon will pair with a tRNA anticodon • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid • Anticodon: 3 Nitrogen base sequence in tRNA

31. Translation (cont.) • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

32. How do you know what amino acids make up a particular protein? • We use an mRNA codon chart

33. Where in the cell does transcription, the first part of protein synthesis, take place? • Mitochondria • Nucleus • Ribosomes • Cytoplasm

34. DNA has the directions to make what? • Glucose • Nucleotides • Proteins • Monosaccharides

35. After a strand of mRNA is made where does it go? • Ribosome • Mitochondria • Lysosome • Vacuole

36. Where in the cell does translation, the second part of protein synthesis, take place? • Mitochondria • Nucleus • Golgi body • Cytoplasm

37. Molecules called tRNA’s are floating around the cytoplasm carrying what? • mRNA’s • Glucose • DNA • Nucleotides • Amino Acids

38. An mRNA codon is made up of how many nitrogen bases? • 1 • 3 • 6 • 24

39. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? • Phenylalanine • Glutamine • Asparagine • Lysine • Tyrosine

40. What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C • Threonine – phenylalanine – glutamate – tyrosine • Phenylalanine – leucine – methionine – valine • Tyrosine – glutamate – phenylalanine – threonine • Lysine – cysteine – arginine – histidine

41. What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G • Isoleucine – alanine – histidine – alanine • Isoleucine – histidine – alanine – isoleucine • Phenylalanine – leucine – valine – arginine • Isoleucine – leucine – threonine – lysine

42. How would you assess your comprehension of DNA & Protein Synthesis? • A • B • C • D