Molecular cytogenetics
Molecular cytogenetics. LIMITS OF THE KARYOTYPE?. 10 %. Identified chromosomal anomalies. Normal karyotype. 90 %. Depends on the level of resolution. Exon: 50 à 1000 pb. ATGCACTGATGAATGCATGCAAT. Molecular genetics. Gene (mean): 2x10 4 pb. Molecular cytogenetics. Band: 2x10 6 pb.
Molecular cytogenetics
E N D
Presentation Transcript
LIMITS OF THE KARYOTYPE? 10 % Identified chromosomal anomalies Normal karyotype 90 %
Depends on the level of resolution Exon: 50 à 1000 pb ATGCACTGATGAATGCATGCAAT • Molecular genetics Gene (mean): 2x104 pb • Molecular cytogenetics Band: 2x106 pb • Standard karyotyping Chromosome: 2x108 pb Genome: 3.5x109 pb
HISTORY • First implementation of in situ hybridization in 1969 (radioactive technique; Gall and Pardue; John et al.) • Ward et Van der Ploeg (1982) used the fluorescence : • Esier to use • Easier to store • Higher resolution • Combination of different fluorochromes • Principle: based on the possibility for DNA to be denatured and renatured (hybridization)
Fluorochrome Fluorochrome Principle of the molecular cytogenetics • Need for a probe • Sequence of oligonucleotides specific for a genomic region • Labeling the probe C C A A T T G G G T G G G G T T A A A T T C C C C C
Principle of the molecular cytogenetics PROBE CHROMOSOME = TARGET DENATURATION HYBRIDIZATION (RENATURATION)
Molecular cytogenetics • Targeted analysis • Fluorescence in situ Hybridization (FISH) • Genome wide analysis • Multifluorescence analysis (multi FISH) • Comparative Genomic Hybridization (CGH) • Micro-arrays
Molecular cytogenetics • Targeted analysis(FISH)
FISH : different types of probes • Specific • For a single locus • For several loci • telomeres (TTAGGG)n • centromeres (satellite DNA) • Painting • total = 1 chromosome pair • partial = part of a chromosome (short arm…)
Interphase, metaphase ? • Interphase nuclei • Amniocytes, lymphocytes, buccal cells
Interphase, metaphase? • Interphase nuclei • Amniocytes, lymphocytes, buccal cells • Characterization • Copy number of a given chromosome • Sex • Allow the analysis of a large number of nuclei • Late identification of echographic anomaly • Characterization of a mosaic • Complex rearrangement (ex: hemopathies)
INTERPHASE FISH ON AMNIOCYTES • Advantages • Rapid diagnostic : 24 h • Result even when no metaphase (culture failure) • Targeted analysis • Disadvantage • Targeted analysis
Interphase, metaphase? • Metaphase nuclei • Usually following a lymphocyte culture • Possible on fibroblasts, bone marrow… • Every cell that is able to proliferate
On metaphase nuclei • Analysis of the microdeletion syndromes • Analysis of the subtelomeric regions • Characterization of the rearrangements (add, dup, del, mar, cryptic translocations…)
On metaphase nuclei • Analysis of the microdeletion syndromes • Microdeletion: cryptic chromosomal rearrangement • Specific for a clinically recognizable syndrome • About 20 microdeletion syndromes • 1/1000 newborns
On metaphase nuclei • Most frequent microdeletion syndromes • 22q11.2 microdeletion syndrome • Williams syndrome • Prader-Willi/Angelman syndromes • ...
22q11.2 microdeletion • Frequency 1/4000 • Major inter et intra-familial phenotypic variability • Two syndromes • DiGeorge syndrome • Velo-cardio-facial syndrome
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism - round face - wide nasal bridge - narrow palpebral fissures
22q11.2 microdeletion - Thin fingers
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects
Conotruncal congenital heart defects • 75% of the patients present with a CHD • Tetralogy of Fallot (22% of the patients) • aortic arch interrupted (15%) • ventricular septal defect (13%) • other cardiopathy (19%)
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects • Thymic hypoplasia (immune deficiency) • Hypocalcemia • Velocardiofacial syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects • Cleft palate • Delayed milestones
Confirmation of the diagnosis • Karyotype + FISH • 94% de novo deletions • 6% inherited deletions • Rare translocations • Parental analysis +++ • Recurrence risk • 50% when inherited • <1% when de novo
Genes in the region • About 25 genes • Major gene : • TBX1 (T-box 1) • Modifier gene: • VEGF (vascular endothelial growth factor) outside of the critical deleted region
Molecular cytogenetics • Targeted analysis • Hybridization in situ en fluorescence (FISH) • Genome wide analysis • Multifluorescence analysis (multi FISH) • Comparative Genomic Hybridization (CGH) • Micro-arrays
Array Solinas-Toldo et al. Genes Chromosomes Cancer 1997;20:399-407 Pinkel et al. Nat Genet 1998;20:207-211 Comparative Genomic Hybridization array (array CGH) Genome wide microdeletion and microduplication detection not identified with a standard karyotype
Principle of array CGH • Genomic DNAs from a patient and a control ( « normal » individual) labeled with two different fluorochromes • Hybridization on an array Duplication + Deletion Control DNA Patient DNA
ArrayCGH • Oligonucleotide array (25 to 60 bases) • Oligoarray CGH 60,000 oligos • 244,000 • 400,000 Deletion Duplication
Proof of principle: 20 patients with learning disability +/- congenital malformations and a karyotype normal
49/532 (~ 10%) Polymorphisms Nb of probes Nb of patients de novo ano Inherited ano Vissers et al. 20 2 (10%) 2 3.569 ? Shaw-Smith et al. 50 7 (14%) 5 ~ 3.500 ? Rosenberg et al. 81 4 (5%) 7 ~ 3.500 33 41 4 (10%) 0 42 Schoumans et al. 2.600 140 ~ 3.500 65 Menten et al. 11 (8%) 7 De Vries et al. 100 10 (10%) 32.447 258 ? 100.000 SNP Friedman et al. 100 11 (11%) ? 3125
Chr 13 normal Der 13
array CGH : del(22)(q12.2) Pulmonary valvular stenosis Delayed milestones Myopia Mild facial dysmorphism
15 years Acoustic neurinoma del(22)(q12.2)
Identification of new microdeletion/microduplication syndromes
Madam A. is pregnant at 22 weeks gestation without any family history. At ultrasound examination, the fetus presents with a congenital heart defect (tetralogy of Fallot) 1. Which information do you deliver to the couple ? 2. Which exam do you propose ?
22q11.2 microdeletion • Frequency 1/4000 • Major inter et intra-familial phenotypic variability • Two syndromes • DiGeorge syndrome • Velo-cardio-facial syndrome
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism - round face - wide nasal bridge - narrow palpebral fissures
22q11.2 microdeletion - Thin fingers
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects
Conotruncal congenital heart defects • 75% of the patients present with a CHD • Tetralogy of Fallot (22% of the patients) • aortic arch interrupted (15%) • ventricular septal defect (13%) • other cardiopathy (19%)
22q11.2 microdeletion • DiGeorge syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects • Thymic hypoplasia (immune deficiency) • Hypocalcemia • Velocardiofacial syndrome • Craniofacial dysmorphism • Conotruncal congenital heart defects • Cleft palate • Delayed milestones
Confirmation of the diagnosis • Karyotype + FISH • 94% de novo deletions • 6% inherited deletions • Rare translocations • Parental analysis +++ • Recurrence risk • 50% when inherited • <1% when de novo
Control probe Specific probe