1 / 56

GENE TECHNOLOGY

GENE TECHNOLOGY. Chapter 8. Overview. DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal Cloning Applications of Gene Technology Medical Environmental Agricultural Ethical Issues. Overview: The DNA Toolbox.

Télécharger la présentation

GENE TECHNOLOGY

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GENE TECHNOLOGY Chapter 8

  2. Overview • DNA Cloning • Restriction Enzymes • Gel Electrophoresis and Southern Blotting • Gene Expression Detection • Organismal Cloning • Applications of Gene Technology • Medical • Environmental • Agricultural • Ethical Issues

  3. Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA • In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the same DNA molecule

  4. Methods for making recombinant DNA are central to genetic engineering, the direct manipulation of genes for practical purposes • DNA technology has revolutionized biotechnology, the manipulation of organisms or their genetic components to make useful products • An example of DNA technology is the microarray, a measurement of gene expression of thousands of different genes

  5. Fig. 20-1

  6. DNA cloning yields multiple copies of a gene or other DNA segment • To work directly with specific genes, scientists prepare gene-sized pieces of DNA in identical copies, a process called DNA cloning

  7. DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the laboratory share general features, such as the use of bacteria and their plasmids • Plasmids are small circular extra-chromosomal DNA molecules that replicate separately (autonomously) from the bacterial chromosome • Cloned genes are useful for making copies of a particular gene and producing a protein product

  8. Gene cloning involves using bacteria to make multiple copies of a gene • Foreign DNA is inserted into a plasmid, and the recombinant plasmid is inserted into a bacterial cell • Reproduction in the bacterial cell results in cloning of the plasmid including the foreign DNA • This results in the production of multiple copies of a single gene

  9. Fig. 20-2a Cell containing geneof interest Bacterium 1 Gene inserted intoplasmid Bacterialchromosome Plasmid Gene ofinterest RecombinantDNA (plasmid) DNA of chromosome 2 2 Plasmid put intobacterial cell Recombinantbacterium

  10. Fig. 20-2b Recombinantbacterium Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest 3 Protein expressedby gene of interest Gene ofInterest Copies of gene Protein harvested Basic research andvarious applications 4 Basicresearchon protein Basicresearchon gene Protein dissolvesblood clots in heartattack therapy Human growth hor-mone treats stuntedgrowth Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste

  11. Fig. 20-2 Cell containing geneof interest Bacterium 1 Gene inserted intoplasmid Bacterialchromosome Plasmid Gene ofinterest RecombinantDNA (plasmid) DNA of chromosome 2 Plasmid put intobacterial cell Recombinantbacterium 3 Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest Gene ofInterest Protein expressedby gene of interest Copies of gene Protein harvested Basic research andvarious applications 4 Basicresearchon protein Basicresearchon gene Gene used to alter bacteria for cleaning up toxic waste Gene for pest resistance inserted into plants Protein dissolvesblood clots in heartattack therapy Human growth hor-mone treats stuntedgrowth

  12. Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes cut DNA molecules at specific DNA sequences called restriction sites • A restriction enzyme usually makes many cuts, yielding restriction fragments • The most useful restriction enzymes cut DNA in a staggered way, producing fragments with “sticky ends” that bond with complementary sticky ends of other fragments • DNA ligaseis an enzyme that seals the bonds between restriction fragments

  13. Fig. 20-3-1 Restriction site 5 3 3 5 DNA Restriction enzymecuts sugar-phosphatebackbones. 1 Sticky end

  14. Fig. 20-3-2 Restriction site 5 3 3 5 DNA Restriction enzymecuts sugar-phosphatebackbones. 1 Sticky end DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs. 2 One possible combination

  15. Fig. 20-3-3 Restriction site 5 3 3 5 DNA Restriction enzymecuts sugar-phosphatebackbones. 1 Sticky end DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs. 2 One possible combination DNA ligaseseals strands. 3 Recombinant DNA molecule

  16. Fig. 20-UN5

  17. Fig. 20-UN6

  18. Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

  19. Cloning a Eukaryotic Gene in a Bacterial Plasmid • In gene cloning, the original plasmid is called a cloning vector • A cloning vector is a DNA molecule that can carry foreign DNA into a host cell and replicate there

  20. Producing Clones of Cells Carrying Recombinant Plasmids • Several steps are required to clone the hummingbird β-globin gene in a bacterial plasmid

  21. Fig. 20-4-1 Hummingbird cell TECHNIQUE Bacterial cell lacZ gene Restrictionsite Stickyends Gene of interest Bacterial plasmid ampR gene Hummingbird DNA fragments

  22. Fig. 20-4-2 Hummingbird cell TECHNIQUE Bacterial cell lacZ gene Restrictionsite Stickyends Gene of interest Bacterial plasmid ampR gene Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids

  23. Fig. 20-4-3 Hummingbird cell TECHNIQUE Bacterial cell lacZ gene Restrictionsite Stickyends Gene of interest Bacterial plasmid ampR gene Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carryingplasmids

  24. Fig. 20-4-4 Hummingbird cell TECHNIQUE Bacterial cell lacZ gene Restrictionsite Stickyends Gene of interest Bacterial plasmid ampR gene Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carryingplasmids RESULTS Colony carrying recombinant plasmid with disrupted lacZ gene Colony carrying non-recombinant plasmidwith intact lacZ gene One of manybacterial clones

  25. Fig. 20-UN4 TCCATGAATTCTAAAGCGCTTATGAATTCACGGC 5 3 AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG 3 5 Aardvark DNA A G A T T T T C C A A G Plasmid

  26. Fig. 20-UN7

  27. The hummingbird genomic DNA and a bacterial plasmid are isolated • Both are digested with the same restriction enzyme • The fragments are mixed, and DNA ligase is added to bond the fragment sticky ends • Some recombinant plasmids now contain hummingbird DNA • The DNA mixture is added to bacteria that have been genetically engineered to accept it • The bacteria are plated on a type of agar that selects for the bacteria with recombinant plasmids • This results in the cloning of many hummingbird DNA fragments, including the β-globin gene

  28. Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

  29. Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

  30. Storing Cloned Genes in DNA Libraries • A genomic library that is made using bacteria is the collection of recombinant vector clones produced by cloning DNA fragments from an entire genome • A genomic library that is made using bacteriophages is stored as a collection of phage clones

  31. Fig. 20-5a Foreign genomecut up withrestrictionenzyme or Recombinantphage DNA Bacterial clones Recombinantplasmids Phageclones (a) Plasmid library (b) Phage library

  32. A bacterial artificial chromosome (BAC) is a large plasmid that has been trimmed down and can carry a large DNA insert • BACs are another type of vector used in DNA library construction

  33. Fig. 20-5b Large insertwith many genes Large plasmid BACclone (c) A library of bacterial artificial chromosome (BAC) clones

  34. A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell • A cDNA library represents only part of the genome—only the subset of genes transcribed into mRNA in the original cells

  35. Fig. 20-5 Foreign genomecut up withrestrictionenzyme Large insertwith many genes Large plasmid or BACclone Recombinantphage DNA Bacterial clones Recombinantplasmids Phageclones (a) Plasmid library (b) Phage library (c) A library of bacterial artificial chromosome (BAC) clones

  36. Fig. 20-6-1 DNA innucleus mRNAs in cytoplasm

  37. Fig. 20-6-2 DNA innucleus mRNAs in cytoplasm Reversetranscriptase Poly-A tail mRNA Primer DNAstrand

  38. Fig. 20-6-3 DNA innucleus mRNAs in cytoplasm Reversetranscriptase Poly-A tail mRNA Primer DNAstrand DegradedmRNA

  39. Fig. 20-6-4 DNA innucleus mRNAs in cytoplasm Reversetranscriptase Poly-A tail mRNA Primer DNAstrand DegradedmRNA DNA polymerase

  40. Fig. 20-6-5 DNA innucleus mRNAs in cytoplasm Reversetranscriptase Poly-A tail mRNA Primer DNAstrand DegradedmRNA DNA polymerase cDNA

  41. Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

  42. Screening a Library for Clones Carrying a Gene of Interest • A clone carrying the gene of interest can be identified with a nucleic acid probe having a sequence complementary to the gene • This process is called nucleic acid hybridization

  43. A probe can be synthesized that is complementary to the gene of interest • For example, if the desired gene is – Then we would synthesize this probe (Why??) … … 5 G G C T A A C T T A G C 3 C C G A T T G A A T C G 5 3

  44. The DNA probe can be used to screen a large number of clones simultaneously for the gene of interest • Once identified, the clone carrying the gene of interest can be cultured

  45. Fig. 20-7 • TECHNIQUE Radioactivelylabeled probemolecules ProbeDNA Gene ofinterest Multiwell platesholding library clones Single-strandedDNA from cell Film Nylon membrane Nylonmembrane Location ofDNA with thecomplementarysequence

  46. Expressing Cloned Eukaryotic Genes • After a gene has been cloned, its protein product can be produced in larger amounts for research • Cloned genes can be expressed as protein in either bacterial or eukaryotic cells

  47. Bacterial Expression Systems • Several technical difficulties hinder expression of cloned eukaryotic genes in bacterial host cells • To overcome differences in promoters and other DNA control sequences, scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter

  48. Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors helps avoid gene expression problems • YACs behave normally in mitosis and can carry more DNA than a plasmid • Eukaryotic hosts can provide the post-translational modifications that many proteins require

  49. One method of introducing recombinant DNA into eukaryotic cells is electroporation, applying a brief electrical pulse to create temporary holes in plasma membranes • Alternatively, scientists can inject DNA into cells using microscopically thin needles • Once inside the cell, the DNA is incorporated into the cell’s DNA by natural genetic recombination

  50. Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA • A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

More Related