vincent-warner
Uploaded by
64 SLIDES
826 VUES
660LIKES

Gene Technology

DESCRIPTION

Gene Technology. Human manipulation of the DNA code of an organism in order to: Make transgenic organisms (done using recombinant DNA) Clone an organism Perform Gene therapy. Genetic Engineering. Organisms which express a gene from another organism. Transgenic Organisms.

1 / 64

Télécharger la présentation

Gene Technology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Gene Technology

  2. Human manipulation of the DNA code of an organism in order to: • Make transgenic organisms (done using recombinant DNA) • Clone an organism • Perform Gene therapy Genetic Engineering

  3. Organisms which express a gene from another organism Transgenic Organisms • Insert gene of interest into another organism, receiving organism now makes the protein from that gene

  4. Plants with “resistance” genes or “insecticide genes” Transgenic Organisms EXAMPLE: DNA alteration is done in plants to develop seeds which are resistant to herbicides the farmer sprays to destroy weeds.

  5. Cows with extra copies of growth hormones Transgenic Organisms

  6. Insulin making bacteria Transgenic Organisms

  7. AND….most importantly????

  8. Cool glow in the dark mice (or worms)!

  9. Diabetes: mutated insulin gene which creates a dysfunctional insulin protein; RESULT: no or low amounts of insulin protein made QUESTION: How can we get insulin that is of “consistent strength”, high purity and easy to make in large quantities (low cost). Making Insulin for Diabetics

  10. Bacteria have circular pieces of DNA called Plasmids They can replicate, transcribe and translate any genes on the plasmid Use bacteria as AN “INSULIN FACTORY”

  11. What does a Plasmid look like?

  12. We can actually take out the plasmid, add genes and reinsert the plasmid into the bacteria How do we work with plasmids?

  13. In plasmids there are specific sequences called restriction sites. Restriction sites are locations on a DNA molecule containing specific sequences of nucleotides Restriction Sites restriction site

  14. Restriction enzymes recognize the sites and cut the DNA at that site Restriction Enzymes

  15. Each restriction enzyme recognizes and cuts a different sequence Restriction Enzymes are Specific Examples: Restriction Enzyme Restriction Site EcoRI GAATTC Hind III AAGCTT BamH1 GGATCC

  16. Restriction enzymes recognize the sites and cut one strand of the DNA at that site How Restriction Enzymes Work CACCTAGCTAG AATTCGACTAGCGAT GTGGATCGATCTTAA GCTGATCGCTA

  17. CACCTAGCTAG AATTCGACTAGCGAT CACCTAGCTAGAATTCGACTAGCGAT GTGGATCGATCTTAAGCTGATCGCTA GTGGATCGATCTTAA GCTGATCGCTA How Many Pieces do you get?

  18. CACCTAGCTAG AATTCGACTAGCGAT GTGGATCGATCTTAA GCTGATCGCTA Single stranded ends are “sticky” • Want to bind to complementary bases

  19. We can take advantage of this and insert any gene we want into the breaks Adding the Insulin Gene Insulin

  20. What enzyme can we use to “seal the gaps” between plasmid DNA and insulin DNA? Sealing the ends of the insulin Gene Insulin Ligase

  21. Put plasmid back into bacteria (a process called transformation) Bacteria will transcribe and translate our insulin gene even though the insulin protein doesn’t do anything for a bacterial cell. Then we can take out the insulin protein and use it to treat diabetics. Transformation

  22. Step 1. ____Isolate_________ the plasmid DNA and human (or other ) gene of interest • Step 2 Use ___restriction___ enzymes to cut both the __plasmid__ and the gene DNA you wish to insert • Step 3. Seal the sticky ends using ____DNA Ligase___________ • The recombinant DNA plasmids are then reinserted and reincorporated into the bacteria. Making Insulin using a vector

  23. Recombinant DNA (rDNA) is DNA that has been created artificially. DNA from two or more sources is incorporated into a single recombinant molecule. Recombinant DNA summary

  24. Better Crops (drought & insect resistance) Larger livestock (cows, chickens, hogs) Recombinant Vaccines (ie. Hepatitis B) Prevention and cure of sickle cell anemia Prevention and cure of cystic fibrosis Production of clotting factors Production of insulin Plants that produce their own insecticides Germ line and somatic gene therapy Recombinant DNA – WHY???

  25. An organism that is genetically identical toits parent What is a clone?

  26. Mammals usually fuse info from two parents (sexual reproduction) Cloning takes all the chromosomes from 1 parent, (but does use “different cells”) How does Cloning work?

  27. Take 1 body cell (udder) Extract Nucleus Sheep 1 Take 1 egg cell Remove nucleus Sheep 2 How do we clone?

  28. HOW DO WE CLONE? Zap to stimulate cell division Implant embryo into surrogate sheep (sheep 3) Inject nucleus into Egg

  29. NOW WE WAIT FOR DOLLY…. Which sheep is Dolly identical to?? Why? Which sheep have to be female?

  30. Somatic cell (2N chromosomes) was used from one animal (this is who we are cloning). We extract and keep the nucleus (get rid of the rest) Egg cell from a second animal (nucleus contains only 1n chromosomes) Extract and get rid of nucleus and keep the cell Fuse the two together  zygote  put into a 3rd sheep to gestate. Cloning Dolly (summary)

  31. Original, Clone and surrogate Snuppy surrogate

  32. Scientific experimentation Maintain a genetic line (good sire or dam) Why DO WE CLONE? Two mini clone pigs, nine days after they were born. Their internal organs are quite similar with those of human beings and are used for organ transplant experiments.

  33. Coming next????? CLONING

  34. What do we know about the human genome>

  35. What it did do: Tell us each an every nucleotide of the human genome (all 3.2 billion) • GOALS WERE: • identify all the approximately 20,000-25,000 genes in human DNA, • determine the sequences of the 3 billion chemical base pairs that make up human DNA, • store this information in databases, • improve tools for data analysis, • transfer related technologies to the private sector, and • address the ethical, legal, and social issues (ELSI) that may arise from the project. • What it did not do: Tell us what it all means!!! Human Genome Project

  36. Now we have to break it down and determine: - which pieces are genes - which pieces are junk - what info the genes hold. Human Genome Project…where are we?

  37. Bioinformatics Where do we store all this information?

  38. Bioinformatics The application of computer science to the field of molecular biology. Bioinformatics now includes the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data.

  39. BLAST finds regions of similarity between biological sequences. • You can use a sequence of nucleotides (nucleotide BLAST) or amino acids (protein BLAST) • For example, following the discovery of a previously unknown gene in the mouse, a scientist will typically perform a BLAST search of the human genome to see if humans carry a similar gene;. BLAST sequence

  40. Each of you has similar genes, but within the genes are unique sequences that identify “you” You receive some sequences from your mother, and some from your father. In most offspring, some can be seen from each parent. We can establish paternity, guilt, etc. What else can we do with “DNA pieces”

  41. Used to compare two people’s DNA Used in paternity cases Used for crime scene analysis DNA Fingerprinting

  42. DNA FINGERPRINT

  43. Based on the idea that EVERYONE’s DNA is unique, like a fingerprint BUT related individuals will have more similarities HOW IS A FINGERPRINT DONE? IDEA BEHIND FINGERPRINTING

  44. Get a sample of DNA and digest it with restriction enzymes If everyone’s DNA is unique, the enzyme will cut each persons DNA differently Example: TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA Creating a Fingerprint

  45. Run cut up DNA on through electrophoresis Click herefor animation Small pieces travel fast and move further down the gel slab. Large pieces move slower and stay closer to the injection point. RESULT: Different fragments of DNA

  46. A DNA ladder is a solution of DNA molecules of different lengths used in agarose gel electrophoresis. It is applied to an agarose gel as a reference to estimate the size of unknown DNA molecules. DNA Ladder

  47. Although 99.9% of human DNA sequences are the same in every person, enough of the DNA is different to distinguish one individual from another, unless they are monozygotic twins.[2] VNTR sequences

  48. DNA profiling uses repetitive ("repeat") sequences that are highly variable,[2] called variable number tandem repeats (VNTRs), VNTR locations on a gene (loci) are very similar between closely related humans, but so variable that unrelated individuals are extremely unlikely to have the same VNTRs. DNA profiling (FINGERPRINTING) and VNTR LOCATIONS

More Related