Characterization of IPMI LSU Gene Variants in cDNA Clones and T-DNA Insertions
This document details the sequence analysis of the 5’ upstream region and partial intron of the IPMI LSU gene (At4g13430) across three different cDNA clones. It highlights the detection of left borders in two variants (ipmi.lsu1-2 and ipmi.lsu1-3) following T-DNA insertions and their effects on nucleotide sequences. The analysis includes the N-terminal amino acid sequences from both wild-type and allele variations, with implications for chloroplast import prediction based on coding sequence modifications. Supplementary figures provide visual context to the findings.
Characterization of IPMI LSU Gene Variants in cDNA Clones and T-DNA Insertions
E N D
Presentation Transcript
A ipmi lsu1-1 LB -89 -9 AACCCCTTTA GGTTTTTTCT AACACACGCC TCTAATCTCC GCGCACACAC ACACACCCTC ACGAAGAAGA AGAAGACGAA GAAGAATCAATGGCTTCTGT TATCTCTTCC TCTCCTTTTC TATGCAAATC ATCCTCCAAGGTTATTCATC TATCCTTCAT ipmi lsu1-2 LB LB -169 -89 -9 CTAGAGACTC TCTCACAGTC AACGCAGCTT ATGTGTCATA GTAAGACTTT TTGTCTACTA TAGTAGAAAG ACGAATTTAT AACCCCTTTA GGTTTTTTCT AACACACGCC TCTAATCTCC GCGCACACAC ACACACCCTC ACGAAGAAGA AGAAGACGAA GAAGAATCAATGGCTTCTGT TATCTCTTCC TCTCCTTTTC TATGCAAATC ATCCTCCAAGGTTATTCATC TATCCTTCAT ipmi lsu1-3 LB LB -89 -9 AACCCCTTTA GGTTTTTTCT AACACACGCC TCTAATCTCC GCGCACACAC ACACACCCTC ACGAAGAAGA AGAAGACGAA GAAGAATCAATGGCTTCTGT TATCTCTTCC TCTCCTTTTC TATGCAAATC ATCCTCCAAGGTTATTCATC TATCCTTCAT Sequence of the 5’ upstream region, of exon 1 (bold letters) and a part of intron 1 (grey letters) of the IPMI LSU gene (At4g13430). The 5’ terminal nucleotides of three different cDNA clones are given in blue (cDNA clones RAFL 05-19-F17 and RAFL 09-81-N04) and red (RAFL 05-21-C12) letters. In ipmi lsu1-2 (SAIL 369G04) and ipmi lsu1-3 (GABI Kat 452D03) two left borders (LB) were detected. In these lines the insertion deleted 32 (GABI Kat 452D03) and 44 (SAIL 369G04) nucleotides (underlined) in the genomic sequence. In the line ipmi lsu1-1 (SALK 029510) only a single left border was found. Numbering is given in respect the ATG. The underlined A is position +1. Knill et al., Supplemental Figure 2A
Stop P S Y S L L I H V D F P D M K P F T I E Y I L Q E E S M A S V I S S S … Stop S P R T H T H P H E E E E D E E E S M A S V I S S S … B ipmi lsu1-3 wt target P cp mt else Predotar cp mt else ipmi lsu1-3 0.875 0.014 0.012 0.04 0.01 0.96 wt 0.973 0.023 0.021 0.96 0.02 0.04 N-terminal amino acid sequences from the IPMI LSU1 wild-type and the ipmi lsu1-3 alleles. In ipmi lsu1-3 the T-DNA insertion upstream of the “normal” predicted ATG (red) extends the reading frame by introducing an in frame translation start codon (blue). This reduces the probability for the import into chloroplasts (cp) predicted by target P (http://www.cbs.dtu.dk/services/TargetP/) and Predotar (http://urgi.versailles.inra.fr/predotar/predotar.html). Mt: mitochondria; else: elsewhere. Knill et al., Supplemental Figure 2B
