1 / 8

DNA Structure and Function

This text discusses various aspects of DNA structure and function, including hydrogen bonding, complementary base pairing, hairpin and cruciform structures, methylcytosine residues, AP sites, denaturation, sequencing, and DNA damage.

hortonl
Télécharger la présentation

DNA Structure and Function

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chap. 8. Problem 1. Hydrogen bonds can potentially be formed to each of the four nitrogen atoms in a purine ring (N-1, N-3, N-7, and N-9). Since N-1 is involved in Watson-Crick base pairing to cytosine in DNA, and N-9 is tied up in the N-glycosyl linkage to deoxyribose in the nucleotides of DNA and has very limited hydrogen bonding ability, only N-3 and N-7 are freely available to form other hydrogen bonds.

  2. Chap. 8. Problem 2. The base sequence of a DNA strand complementary to a written sequence is conventionally written in the left-to-right (5’ to 3’) direction, even though its sequence runs right-to-left relative to the printed sequence. The sequence of the complementary strand therefore is (5’)GCGCAATATTTTGAGAAATATTGCGC(3’). As shown by writing the double-helical sequence of this DNA, this DNA segment contains a palindrome, which is underlined. (5’)GCGCAATATTTCTCAAAATATTGCGC(3’) (3’)CGCGTTATAAAGAGTTTTATAACGCG(5’) A single DNA strand containing this sequence therefore has the potential to form a hairpin structure. The two strands together in double-helical DNA could form a cruciform structure.

  3. Chap. 8. Problem 5. Both single-stranded DNAs and RNAs will form hairpin structures if they contain complementary regions. In the double-helical parts of both DNA and RNA hairpins, the nucleic acid strands are oriented antiparallel to one another. However, RNA is unable to form a B-form double helix, and exists instead in an A-form helix. DNA hairpins adopt standard B-form helices. The reason for this difference is that the 2’-hydroxyl groups in the ribose residues of RNA make it sterically impossible for a double-helical RNA molecule to adopt a B-form type of helix.

  4. Chap. 8. Problem 6. Eukaryotic DNAs contain large amounts (about 5%) of 5-methylcytosine residues at CpG sequences due to methylation processes that are involved in the regulation of gene expression. When 5-methylcytosine undergoes spontaneous deamination to thymine, a G/T mismatch pair is produced. Because 5-methylcytosine is prevalent in DNA, G/T mismatches are common. Therefore, a specialized system that repairs G/T mismatches to G/C (and not A/T) base pairs has evolved.

  5. Chap. 8. Problem 8. As a result of the loss of the purine base at an apurinic (AP) site, structural changes occur that lead to destabilization of double-helical DNA. First, the deoxyribose formerly holding the purine base can open to its linear aldehyde form. Second, base stacking interactions between the apurinic nucleotide and its neighbors are lost. These changes destabilize the local structure of the double helix in the affected region.

  6. Chap. 8. Problem 10. The bases in double-helical DNA are stacked on top of one another inside the helix. In this environment, they are less exposed to light directed upon them. However, when DNA is denatured, the bases of the individual single strands move out of the interior of the double helix and are more exposed to light focused on the solution. For this reason, a hyperchromic effect is observed where the absorption of UV light by the solution containing the denatured DNA increases.

  7. Chap. 8. Problem 13. If dCTP were omitted from the “C” sequencing reaction, ddCTP would be incorporated into the growing chain synthesized by the DNA polymerase as soon as it encountered the first G residue in the template. No chains longer than this product would be made, and only one band corresponding to this product would appear in the sequencing gel. Under these conditions, the C reaction would not work correctly.

  8. Chap. 8. Problem 16. (a) Water participates directly in DNA damaging reactions such as depurination. It also is the solvent in which mutation-causing enzymes operate. Thus the low water content of spores is protective against the accumulation of mutations in DNA. (b) Cyclobutane dimers are formed by the absorption of UV light by adjacent pyrimidines in DNA. Spores of B. subtilis are constantly at risk of being exposed to UV light when the soil is disturbed and spores are lifted into the air and deposited on the soil surface. The SASP proteins therefore have evolved to help protect the genetic information stored in spore DNA.

More Related