1 / 21

How to use SSRHunter

This tutorial demonstrates how to download and install SSRHunter software, use it to identify potential SSRs in a sequence, and design a PCR-based molecular marker. Follow the step-by-step instructions to maximize the efficiency of SSR analysis.

javierl
Télécharger la présentation

How to use SSRHunter

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. How to use SSRHunter Hui Wang OARDC E-mail:wang.t3@osu.edu

  2. Purpose of this tutorial • To demonstrate how to download and install SSRHunter software. • Demonstrate use of SSRHunter to identify potential SSRs in a sequence. • To demonstrate how to design a PCR-based molecular marker for a Simple Sequence Repeat (SSR) using SSRhunter. • Hayden, M.J. and P.J. Sharp. 2001. Nucleic Acids Research 29 (8):e44. • Li, Q., and Wan, J. M.. Yi chuan. 2005. SSRHunter: development of a local searching software for SSR sites.

  3. SSR hunter • Software language: Chinese and English • Operating Systems: Win9x/Me/NT/2000/XP/2003

  4. Search for “ssrhunter” Click this link!!! That is what I want!!!

  5. Download Page ------------Scroll Down!!!

  6. Click here!!!

  7. Wait 5 seconds!!!

  8. Save or open the program!!! I recommend you SAVE to the DESKTOP and then unpack.

  9. Save to Desktop

  10. Download Complete!!! Click open folder, and Click on the .exe file

  11. 1:Choose options 2:Paste in sequence 3:Click Run

  12. This option means the maximum nucleotide repeat unit. eg:attg Simply paste the sequences in this box. The bigger size, the longer processing time. I have used sequences up to ~200Mb. This option means the minimum repeat. eg:attgattgattgattgattg or (attg)5 Click to RUN!!!

  13. No.; repeat; # repeats; position 1:scaffold06004:2320000-2460000 sequence for example Output file!!!

  14. Copy output into a Word or text file.

  15. 24. ACA 重复次数: 6 • scaffold06004:: 2419808-2420125 • 99808aatagaggcacataagttacaattaaatagatatcagtacgttctcaataatcgggaaaacaaaatagaagagaaaaaggcaggtgatgaactaagttttcctataaaatagtttatgcttaattttacagctaaaggttgtggaagttgACAACAACAACAACAACAtacctactgtagttccacaagtggggtctgggaatgttaggatgtacacaaaccttaaccctacctttgttgtggaagttgccaaaaaaacaaaaactctatggttgcttggttcagagatatttgaggaccttttctgcaatatcctca 100125 Output contains information for many possible SSR sequences. One example is shown here.

  16. What is the next step? .Primer3 to design your primer according to the SSR hunter output. http://frodo.wi.mit.edu/primer3/ (Uniform Resource Locator for Primer3)

  17. Simply paste the sequences in this box. Select product size (I suggest 150-250) Click to pick primers!!!

  18. There are the primers!!!

  19. What is the last step? . Run PCR and separate fragments for validation. . In my experience, more than 60% of putative SSRs identified with SSRHunter detect polymorphisms.

  20. In this example, 3%agarose 3h detects a polymorphism. That is what I want!!!

  21. Thank you!!!

More Related