jett
Uploaded by
48 SLIDES
774 VUES
480LIKES

break

DESCRIPTION

4: Genome evolution. break. Exon Shuffling . 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication) exon insertion = exchange of domains between genes or insertions into a gene

1 / 48

Télécharger la présentation

break

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 4: Genome evolution break

  2. Exon Shuffling

  3. 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication) exon insertion = exchange of domains between genes or insertions into a gene exon deletion = the removal of a segment from a gene.

  4. Mosaic (or chimeric) protein = a protein encoded by a gene that contains regions also found in other genes. The existence of such proteins provides evidence of exon shuffling.

  5. exon shuffling  mosaic proteins

  6. 4: Genome evolution break

  7. Blood Clotting

  8. Clotting - History 1863: Joseph Lister showed that blood is a fluid inside an ox, and undergoes clotting when put on a test glass.

  9. Clotting – The end reaction thrombin fibrinogen fibrin

  10. Clotting thrombin fibrinogen fibrin After the wound is healed… plasmin no fibrin (peptides)

  11. After the wound is healed… Plasmin should only be activated when the wound is healed. Plasmin is created from plasminogen by an enzyme called plasminogen activator (TPA). Tissue type plasminogen activator (TPA) plasminogen plasmin fibrin no fibrin

  12. Heart attacks If TPA is given 1h after a heart attack it significantly increases the chance of surviving. (If you run out of TPA chewing aspirin will also do) Tissue type plasminogen activator (TPA) plasminogen plasmin fibrin no fibrin

  13. After the wound is healed… Urokinase catalyzes the same reaction as TPA. urokinase tissue type plasminogen activator (TPA) plasminogen plasmin fibrin no fibrin

  14. After the wound is healed… Prourokinase is the precursor of urokinase prourokinase urokinase tissue type plasminogen activator (TPA) plasminogen plasmin fibrin no fibrin

  15. After the wound is healed… Prourokinase and TPA are very similar. They both catalyze the same reaction (prourokinase only after it is cleaved to urokinase). But, the difference is that TPA interacts with fibrin and urokinase – does not. prourokinase urokinase tissue type plasminogen activator (TPA) plasminogen plasmin fibrin no fibrin

  16. Prourokinase and TPA – the domains The difference is that TPA has another domain, the F1 domain (43 amino acids) that is missing in prourokinase. F1 = fibronectine type 1 module. F1 is responsible for the affinity of TPA to fibrin. TPA F1 EG KR KR Protease Prourokinase EG KR KR Protease

  17. Prourokinase and TPA – the domains What is the origin of the F1 domain? TPA F1 EG KR KR Protease Prourokinase EG KR KR Protease

  18. Prourokinase and TPA – the domains It probably came from another protein, called fibronectin. F1 F1 F3 F4 F3 F5 F3 F1 F2 6 2 3 9 5 3 S-S S-S F1 F1 F3 F4 F3 F5 F3 F1 F2 6 2 3 9 5 3 Six repeats of F1 F2 = Collagen binding domain F3 = Heparin biding domain F4 = Cell binding domain

  19. Fibronectin Fibronectin can connect (F4) fibroblasts to fibrin (F1) to repair site of injury. F1 F1 F3 F4 F3 F5 F3 F1 F2 6 2 3 9 5 3 S-S S-S F1 F1 F3 F4 F3 F5 F3 F1 F2 6 2 3 9 5 3 Six repeats of F1 F2 = Collagen binding domain F3 = Heparin biding domain F4 = Cell binding domain

  20. Much more complicated In fact, there are other domains in the clotting system that resemble each other. It looks like a big complicated puzzle of domain shuffling.

  21. AP = apple module; EG = epidermal growth-factor; F1 & F2 = fibronectin type-1 & type-2; GA = g-carboxy-glutamate domain; KR = kringle

  22. TPA acquired its exons from other genes…

  23. There are also many computer programs that analyze a given sequence, and search for homology in known existing domains.

  24. 4: Genome evolution break

  25. Phase limitations on exon shuffling

  26. The phase of an intron ATGGGATTCGTTAGCCATTT Exon Exon Intron of phase 0: lies between two codons

  27. The phase of an intron ATGGGATGTTAGTCCCATTT Exon Exon Intron of phase 1: lies between the first and second positions of a codon

  28. The phase of an intron ATGGGATTGTTAGCCCATTT Exon Exon Intron of phase 2: lies between the second and third positions of a codon

  29. The class of an exon GTTAGCCATTTGTT Exon of class 0-0. Starts at the beginning of a codon, and ends at the end of a codon.

  30. The class of an exon GTTAGCCATTTGTT Exon of class 0-1. Starts at the beginning of a codon, and ends between positions 1 and 2 of a codon.

  31. The class of an exon GTTAGCCATTTGTT Exon of class? Exon of class 2-1. Starts between positions 2 and 3 of a codon and ends between positions 1 and 2 of a codon.

  32. Symmetrical exons. GTTAGCCATTTGTTT Symmetrical exons are those that are multiples of 3 nucleotides? (Otherwise, they are asymmetrical).

  33. Tandem duplication of symmetrical exons GTTAGCCATTTGTTT GTTAGCCATTTGTGCCATTTGTTT Tandem duplication of symmetrical exons will not cause a frameshift mutation.

  34. Deletion of symmetrical exons GCGTTAGCCATTTGTTTATTT Deletion of symmetrical exons will not cause a frameshift mutation.

  35. What about exons insertion? GTTAGCCATTTGTTTACCGATTTCAC Only symmetrical exons can be inserted without causing a frameshift mutation.

  36. What about exons insertion? GGTACG GTTAGCCATTTGTTTACCGATTTCAC GTTAGCCATTTGTTTAGGTACGCCGATTTCAC But not all symmetrical exons can enter. For example, a 0-0 exon will cause a frameshift if entered.

  37. What about exons insertion? GGTACG GTTAGCCATTTGTTTACCGATTTCAC GTTAGCCATTTGTTTAGGTACGCCGATTTCAC 0-0 exons can only be inserted in phase 0 introns 1-1 exons can only be inserted in phase 1 introns 2-2 exons can only be inserted in phase 2 introns

  38. Prourokinase and TPA – exon classes All recruited exons are of class 1-1. It might be a “frozen accident”: if the first one was 1-1, all the rest should also be 1-1… TPA F1 EG KR KR Protease Prourokinase EG KR KR Protease

  39. 4: Genome evolution break

  40. exonization and exon lost

  41. Splicing In splicing, introns are removed. There are signals in the DNA (in the mRNA) that direct the excision of introns. DNA exon1 exon2 mRNA exon1 exon2 exon1 exon2 mature mRNA exon1 exon2 protein

  42. Exonization Mutations in the DNA that encode signals for intron excision might result in exonization of the intron. mutation in the splicing signal exon1 exon2 DNA exon1 mRNA exon1 exon1 mature mRNA protein exon1

  43. Exon lost Of course, in a similar vain, exons can also be removed due to such mutations. mutation in the splicing signal exon1 exon2 DNA exon1 mRNA exon1 exon1 mature mRNA exon1 protein

  44. 4: Genome evolution break

  45. Multi-domain gene assembly Principal biochemical reactions in the synthesis of fatty acids from malonyl CoA in eukaryotes and eubacteria _____________________________________________________________________________________________________________________ ReactionEnzyme _____________________________________________________________________________________________________________________ 1. acetyl CoA + condensing-enzyme domain  acetyl-condensing enzyme acetyl transferase 2. malonyl CoA + acyl-carrier peptide  malonyl-acyl-carrier peptide malonyl transferase 3. acetyl-condensing enzyme + malonyl-acyl-carrier peptide b-ketoacyl-carrier peptide b-ketoacyl synthase 4. b-keto-acyl carrier peptide + NADPH + H+b-hydroxyacyl-carrier peptide + NADP+b-ketoacyl reuctase 5. b-hydroxyacyl-carrier peptide  2-butenoyl-acyl-carrier peptide + H2O b-hydroxyacyl dehydratase 6. 2-butenoyl-acyl-carrier peptide + NADPH + H+ butyryl-acyl-carrier peptide + NADP+ enoyl reductase 7. butyryl-acyl-carrier peptide + condensing-enzyme domain  butyryl-condensing enzyme + acyl-carrier peptide thioesterase _____________________________________________________________________________________________________________________ 7 enzymatic activities + 1 acyl carrier protein

  46. Multi-domain gene assembly Principal biochemical reactions in the synthesis of fatty acids from malonyl CoA in eukaryotes and eubacteria _____________________________________________________________________________________________________________________ ReactionEnzyme _____________________________________________________________________________________________________________________ 1. acetyl CoA + condensing-enzyme domain  acetyl-condensing enzyme acetyl transferase 2. malonyl CoA + acyl-carrier peptide  malonyl-acyl-carrier peptide malonyl transferase 3. acetyl-condensing enzyme + malonyl-acyl-carrier peptide b-ketoacyl-carrier peptide b-ketoacyl synthase 4. b-keto-acyl carrier peptide + NADPH + H+b-hydroxyacyl-carrier peptide + NADP+b-ketoacyl reuctase 5. b-hydroxyacyl-carrier peptide  2-butenoyl-acyl-carrier peptide + H2O b-hydroxyacyl dehydratase 6. 2-butenoyl-acyl-carrier peptide + NADPH + H+ butyryl-acyl-carrier peptide + NADP+ enoyl reductase 7. butyryl-acyl-carrier peptide + condensing-enzyme domain  butyryl-condensing enzyme + acyl-carrier peptide thioesterase _____________________________________________________________________________________________________________________ In most bacteria, these functions are carried on by discrete monofunctional proteins.

  47. Multi-domain gene assembly Principal biochemical reactions in the synthesis of fatty acids from malonyl CoA in eukaryotes and eubacteria _____________________________________________________________________________________________________________________ ReactionEnzyme _____________________________________________________________________________________________________________________ 1. acetyl CoA + condensing-enzyme domain  acetyl-condensing enzyme acetyl transferase 2. malonyl CoA + acyl-carrier peptide  malonyl-acyl-carrier peptide malonyl transferase 3. acetyl-condensing enzyme + malonyl-acyl-carrier peptide b-ketoacyl-carrier peptide b-ketoacyl synthase 4. b-keto-acyl carrier peptide + NADPH + H+b-hydroxyacyl-carrier peptide + NADP+b-ketoacyl reuctase 5. b-hydroxyacyl-carrier peptide  2-butenoyl-acyl-carrier peptide + H2O b-hydroxyacyl dehydratase 6. 2-butenoyl-acyl-carrier peptide + NADPH + H+ butyryl-acyl-carrier peptide + NADP+ enoyl reductase 7. butyryl-acyl-carrier peptide + condensing-enzyme domain  butyryl-condensing enzyme + acyl-carrier peptide thioesterase _____________________________________________________________________________________________________________________ In fungi, the activities are distributed between two proteins encoded by two unlinked intronless genes, FAS1 and FAS2. FAS1 encodes 3 of the 8 activities (b-ketoacyl synthase, b-ketoacyl reductase, and acyl-carrier protein). FAS2 encodes the rest of the five enzymatic activities.

  48. In animals, all functions are performed by one polypeptide, fatty-acid synthase. The gene product has 8 modules, including one that performs a dual function and another whose function is unrelated to fatty-acid synthesis but may determine the 3D structure of this protein.

More Related