Download
affymetrix snp chips n.
Skip this Video
Loading SlideShow in 5 Seconds..
AFFYMETRIX SNP chips PowerPoint Presentation
Download Presentation
AFFYMETRIX SNP chips

AFFYMETRIX SNP chips

1580 Views Download Presentation
Download Presentation

AFFYMETRIX SNP chips

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. AFFYMETRIX SNP chips Karin Dahlman-Wright Department of Biosciences and BEA Karolinska Institutet

  2. Agenda • Introduction • AFFYMETRIX technology • DNA analysis products • www.affymetrix.com

  3. Introduction

  4. Milestones in Affymetrix history AffymetrixJapan KK Commercial Launch Human Genome2.0 Plus array 1st Expression Product DNA Analysis 1st Microarray Patent Issued IPO Invention of the microarray NimbleExpress™ Photolithography 2001 1996 2004 1989 1990 1991 1992 1993 1994 1995 1997 1998 1999 2000 2002 2003 GeneChip®Scanner3000 Operate Independently CustomExpress™ 1st Catalog Product Commercial DNA Microarray prototype Invention of the microarray scanner Human Genome Set (U133) Rat and MouseGenome2.0 arrays Sacramento manufacturing facility GeneArray® Scanner Cover of Science MD Scanner

  5. Expression variability Sequence variability Affymetrix Gene Chips

  6. Candidate gene analysis Whole genome genotyping CustomSeq™ 30 Kb Mapping 10k and 100k 10,000 and 100,000 genotypes Genome analysis

  7. AFFYMETRIX technology;The Gene Chip

  8. Photolithography 1 Probe DNA sequences are synthesized in predetermined locations on glass wafers using masks to activate photosensitized DNA with UV light.

  9. Photolithography 2 Lamp Mask Array

  10. Synthesizing oligonucleotide arrays

  11. Manufacturing flexibility 49 Chips per Wafer 400 Chips per Wafer

  12. * * * * * Probeconstruction GeneChipProbe Array Hybridized Probe Cell Single stranded, labeled ‘target’ Oligonucleotide ‘probe’ 18 µm Millions of copies of a specific oligonucleotide probe 1.28cm >500,000 different complementary probes 1.28cm

  13. * * * * * Probe construction GeneChipProbe Array Hybridized Probe Cell Single stranded, labeled ‘target’ Oligonucleotide ‘probe’ 11 µm Millions of copies of a specific oligonucleotide probe 1.28cm >1.300,000 different complementary probes 1.28cm

  14. * * * * * Probe construction GeneChipProbe Array Hybridized Probe Cell Single stranded, labeled ‘target’ Oligonucleotide ‘probe’ 8 µm Millions of copies of a specific oligonucleotide probe 1.28cm >2.500,000 different complementary probes 1.28cm

  15. DNA analysis products

  16. 1996 1997 1998 1999 2000 2001 2002 Affymetrix mapping product timeline 2003 HuSNP® Mapping 10K HuSNP® Mapping Assay: 1,500 SNPs Multiplex PCR assay Allele specific hybridization

  17. GDAS 2.0 Software GeneChip® Mapping 10K System GeneChip Mapping 10K Assay GeneChip Scanner 3000 GeneChip Mapping 10K Arrays NetAffx SNP Annotation

  18. Genome coverage: 11,555 SNPs, Mapping 10 K array Median intermarker distance: 105 kb Mean intermarker distance: 210 kb Mean genetic gap distance: 0.32 cM Average Heterozygosity 0 .37

  19. Genome coverage; 100K SNP July 2003 NCBI bld 34 Median intermarker distance: 8 kb Mean intermarker distance: 22.5 kb Average Heterozygosity 0 .29 Average minor allele frequency 0.21

  20. SNP tiling strategy A/G GGTAGCCATGCANGAGTTACTACAG CCATCGGTACGTTCTCAATGATGTC PM Allele A MM Allele A CCATCGGTACGTACTCAATGATGTC CCATCGGTACGTCCTCAATGATGTC PM Allele B CCATCGGTACGTACTCAATGATGTC MM Allele B

  21. ”Offset” probes A/G GCCATGCANGAGTTACTACAGTAGC CGGTACGTTCTCAATGATGTCATCG PM + 4 Allele A MM +4 Allele A CGGTACGTTCTCTATGATGTCATCG CGGTACGTCCTCAATGATGTCATCG PM +4 Allele B CGGTACGTCCTCTATGATGTCATCG MM + 4 Allele B

  22. MM B MM B PM A MM A PM A MM B MM A PM B PM A MM B MM A PM B PM A MM A MM B PM A PM B MM A PM B PM A MM B MM A PM B PM A MM B MM A PM B PM B Each SNP is interrogated by 40 oligonucleotides • 7 quartets were evaluated and 5 were chosen to represent each SNP. • Each SNP is interrogated on forward and reverse strand. • A total of 10 quartets or 40 probes are used to interrogate one SNP. • Dispersed probe pairs. quartet

  23. Xba Xba Xba PCR: One Primer Amplification Complexity Reduction AA BB AB GeneChip® mapping 10K; Assay overview Genomic DNA RE Digestion Adapter Ligation Fragmentation and Labeling Hyb & Wash

  24. Assay details • 250 ng genomic DNA • 50 ng/ul • Reduced EDTA • Amplify to 250 to 1000 base pair fragments • DNA quality control?

  25. Array performance • Accurancy: > 99.5 % Concordance with single base extension over 20.000 calls Mendelian inheritance errors: 0.049 % over 30 trios • Reproducibility: 99.96 % 9 samples x 6 replicates 3 caucasians, 3 african american, 3 asian • Call rate: > 90 %

  26. GDAS • QA report • Genotype call

  27. Discrimination score 1 • Ensures there is sufficient specific hybridization Forward (PMA-MMA) d= PMA (PMA+MMA) MMA If MMA>PMA, discard PMB MMB Reverse PMA MMA PMB MMB

  28. Discrimination score 2 Forward PMA Calculate 4 median discrimination score d fA MMA PMB MMB Calculate d for SNP Reverse PMA d=Max (Min(dfA, drA), Min(dfB, drB) MMA PMB d > 0.08 MMB

  29. RAS score 1 • A RAS score is calculated for each quartet PMA-MMavg R= (PMA-MMavg) + (PMB-MMavg) Reverse Forward 100 PMA PMA MMA 10 MMA 10 PMB PMB MMB 10 MMB 100-10 R= = 1.0 (100-10) + (10-10)

  30. RAS score 2 • Determine median RAS score for forward and reverse strand RASf 1.0 AA AB BB RASr 0 1.0

  31. * * * * * * * * * * 10 k SNP array 4200 SEK 18 µm 2050 SEK 11 µm

  32. * * * * * 100 k SNP array 50 k Xba I 5250 SEK 8 µm 50 k Hind III 5250 SEK

  33. * * * * * 500 k SNP array To be launched Q1, 2005 24 probes per SNP 5 µm

  34. Mix and match 100 k 10 k 50 k 250 k

  35. T T T A T C C T A A C C G T A A C G T • 30kb double-stranded (60 kb total) sequence per chip • sequence can be contiguous or dispersed, any organism • Accuracy=>99.99% • Reproducibility= >99.99% Affymetrix CustomSeq™ arrays

  36. Resequencing strategy ATCGGTAGCCATACATGAGTTACTA ATCGGTAGCCATTCATGAGTTACTA ATCGGTAGCCATCCATGAGTTACTA ATCGGTAGCCATGCATGAGTTACTA ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA TAGCCATCGGTAGGTACTCAATGAT TAGCCATCGGTACGTACTCAATGAT TAGCCATCGGTATGTACTCAATGAT TAGCCATCGGTAAGTACTCAATGAT

  37. Resequencingtiling strategy TCGGTAGCCATGAATGAGTTACTAC TCGGTAGCCATGCATGAGTTACTAC TCGGTAGCCATGGATGAGTTACTAC TCGGTAGCCATGTATGAGTTACTAC ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA AGCCATCGGTAGATACTCAATGATG AGCCATCGGTAGCTACTCAATGATG AGCCATCGGTAGGTACTCAATGATG AGCCATCGGTAGTTACTCAATGATG

  38. Resequencing tiling strategy CGGTAGCCATGCATGAGTTACTACA CGGTAGCCATGCCTGAGTTACTACA CGGTAGCCATGCGTGAGTTACTACA CGGTAGCCATGCTTGAGTTACTACA ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA GCCATCGGTACGAACTCAATGATGT GCCATCGGTACGCACTCAATGATGT GCCATCGGTACGGACTCAATGATGT GCCATCGGTACGTACTCAATGATGT

  39. Resequencing Tiling Strategy GGTAGCCATGCAAGAGTTACTACAG GGTAGCCATGCACGAGTTACTACAG GGTAGCCATGCAGGAGTTACTACAG GGTAGCCATGCATGAGTTACTACAG ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA CCATCGGTACGTACTCAATGATGTC CCATCGGTACGTCCTCAATGATGTC CCATCGGTACGTGCTCAATGATGTC CCATCGGTACGTTCTCAATGATGTC

  40. HTA – High throughput assay

  41. BEA-NOVUMBio-informatics and Expression Analysis at NOVUM • The objective is to support the KI/KS/HS cluster in the field of gene expression and bio-informatics. • Supported by Karolinska Institute, board of research and Wallenberg Consortium North Functions Areas • Provide infrastructure Sequence analysis • Provide analysis tools Expression analysis • Provide service Human genetics • Provide education www.bea.ki.se