280 likes | 488 Vues
Ribonucleic acid : another type of nucleic acid that works with DNA to make proteins. RNA and Protein Synthesis. From nucleus to cytoplasm. transcription. protein. DNA. mRNA. translation. trait. nucleus. cytoplasm. DNA vs. RNA. D NA deoxyribose sugar nitrogen bases G, C, A, T
E N D
Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins RNA and Protein Synthesis
From nucleus to cytoplasm transcription protein DNA mRNA translation trait nucleus cytoplasm
DNA vs. RNA • DNA • deoxyribose sugar • nitrogen bases • G, C, A, T • T : A • C : G • double stranded • 1 type • RNA • ribose sugar • nitrogen bases • G, C, A, U • U : A • C : G • single stranded • 3 types: M, R, & T
Transcription • Making mRNA from DNA • DNA strand is the template (pattern) • match bases • U : A • G : C • Enzyme • RNA polymerase
Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T
Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T
RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T
ribosome A C C A U G U C G A U C A G U A G C A U G G C A Matching bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA
ribosome A C C A U G U C G A U C A G U A G C A U G G C A cytoplasm protein nucleus trait
mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa How does mRNA code for proteins • mRNA leaves nucleus • mRNA goes to ribosomes in cytoplasm • Proteins built from instructions on mRNA How?
TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla protein aa aa aa aa aa aa aa aa How does mRNA code for proteins? How can you code for 20 amino acids withonly 4 DNA bases (A,U,G,C)?
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC ribosome mRNA mRNA ? MetArgValAsnAlaCysAla protein mRNA codes for proteins in triplets • Codon = block of 3 mRNA bases
The mRNA code • For ALL life! • strongest support for a common origin for all life • Code has duplicates • several codons for each amino acid • mutation insurance! • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG
UAC GCA tRNA CAU Met Arg Val How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon anti-codon aminoacid • Anti-codon = block of 3 tRNA bases
ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A G G U U A C aa tRNA A G aa tRNA U A G aa aa tRNA tRNA aa aa mRNA to protein = Translation • The working instructions mRNA • The reader ribosome • The transporter transfer RNA (tRNA) C
aa aa aa aa aa aa aa ribosome A C C A U G U C G A U C A G U A G C A U G G C A tRNA aa From gene to protein transcription translation protein DNA mRNA trait nucleus cytoplasm
TACGCACATTTACGTACG DNA mRNA AUGCGUGUAAAUGCAUGC aa aa aa aa aa aa aa protein trait Mutations • Changes to DNA are called mutations • change the DNA • changes the mRNA • may change protein • may change trait
Types of Mutations 1. Point mutation: change in a single base pair in DNA (substitution) • THE DOG BIT THE CAT • THE DOG BIT THE CAR Missense mutation = changes amino acid Nonsense mutation = change to STOP Silent mutation = no change in protein
Types of Mutations 2. Frameshift mutation: a single base pair is added or deleted and shifts the reading of the codons THE DOG BIT THE CAT THE DOG SBI TTH ECA T
Mutations 3. Chromosomal mutations: any change in the structure or number of chromosomes, common in plants • deletion: part of a chromosome is removed • insertion and translocation: part of a chromosome breaks off and attaches to another chromosome • inversion: part of a chromosome breaks off and is reinserted backwards
A TATA box is a DNA sequence that indicates where a genetic sequence can be read and decoded. It is a type of promoter sequence, which specifies to other molecules where transcription begins. Transcription is a process that produces an RNA molecule from a DNA sequence. The TATA box is named for its conserved DNA sequence, which is most commonly TATAAA. Many eukaryotic genes have a conserved TATA box located 25-35 base pairs before the transcription start site of a gene. The TATA box is able to define the direction of transcription and also indicates the DNA strand to be read. Proteins called transcription factors can bind to the TATA box and recruit an enzyme called RNA polymerase, which synthesizes RNA from DNA.
Examples of chromosomal mutations deletion duplication inversion translocation 12.4
Gene Regulation • Only a small percent of genes are expressed (~3%) • Genes that are expressed have a proteins that control their expression • “TATA box”: sequence at the beginning of a transcription site in eukaryotes
The Operon • Four regions of DNA control the production of a protein • a structural gene that holds the codons for the amino acid sequence found in the enzyme. • an operator region right in front of the structural gene. • a promotor region where the RNA polymerase will bind to the DNA. • a regulator gene which has a role in controling the transcription from the structural gene. • The combined region of the operator and structural gene is called an operon.
operon, genetic regulatory system found in bacteria and their viruses in which genes coding for functionally related proteins are clustered along the DNA. This feature allows protein synthesis to be controlled coordinately in response to the needs of the cell. By providing the means to produce proteins only when and where they are required, the operon allows the cell to conserve energy, which is an important part of an organism’s life strategy. A typical operon consists of a group of structural genes that code for enzymes involved in a metabolic pathway, such as the biosynthesis of an amino acid. These genes are located contiguously on a stretch of DNA and are under the control of one promoter (a short segment of DNA to which the RNA polymerase binds to initiate transcription). A single unit of messenger RNA (mRNA) is transcribed from the operon and is subsequently translated into separate proteins.
Animations http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html# http://learn.genetics.utah.edu/units/basics/firefly/