1 / 30

Decoding Genes: The Journey from DNA to Green Fluorescent Protein

Explore the fascinating processes of transcription and translation, uncovering how genes govern traits. Learn about GFP and its revolutionary role in biology. Investigate biofilm behavior and gene expression control. Dive into the world of molecular biology!

keagan
Télécharger la présentation

Decoding Genes: The Journey from DNA to Green Fluorescent Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription and Translation (How a Gene Works) Alison Kraigsley January 18th, 2011

  2. Overview • Brief Introduction • My background • Research at NIST • Today’s experiment

  3. Overview • Brief Introduction • My background • Research at NIST • Today’s experiment

  4. From DNA to People • DNA is your genetic blueprint • Too valuable to risk damaging • mRNA (messenger RNA) used to transfer the genetic code into protein (specific trait) • DNA codes for hair colour • Protein is the actual hair with colour Transcription Translation DNA mRNA Protein

  5. From DNA to People • DNA is DNA = same for all living things • Genetic code is different • 20,000-25,000 genes in humans (99.5% similar) • 32,000 -56,000 genes in rice (Oryza sativa) • 19,000 genes in earth worm (Caenorhabditis elegans), • 25,000 gene in a plant (Arabidopsis thaliana ) Transcription Translation DNA mRNA Protein

  6. Green Fluorescent Protein (GFP) • Revolutionized biology • GFP tagged genes, cells, proteins • Can tell where/when/how biology is happening • But what is it exactly?

  7. Green Fluorescent Protein (GFP) • GFP comes from the Jellyfish Aequorea victoria. • The gene was cloned (copied) and transferred to other organisms • 2008 Nobel Prize in Chemistry

  8. GFP Stem Cells • Inner glow. Transplanted motor neurons (green) spread out from the spinal cord of an embryonic chick. http://cmbi.bjmu.edu.cn/news/0208/44.htm, Wichterle et al., Directed Differentiation of Embryonic Stem Cells into Motor Neurons, Cell, 2002, 110, 385-397

  9. GFP Reporter • GFP reporter gene expression in central nervous system neurons that innervate the hindgut of Drosophila melanogaster http://www.neuroscience.cam.ac.uk/directory/profile.php?gal26

  10. GFP Reporter • Spliced the right way, fru establishes a “courtship” circuit of neurons (green) in the male fly brain. http://www.sciencemag.org/content/308/5727/1392.full

  11. Overview • Brief Introduction • My background • Research at NIST • Today’s experiment

  12. ME!! • Education • B.Sc. Chemistry/Physic: Furman University, Greenville SC • M.S. Aerospace Engineering: University of Southern California, Los Angeles CA • Ph.D. Molecular Biology: University of Southern California, Los Angeles CA • Research • M.S. : Polymers • Ph.D: Biofilms, evolution • NIST: Biofilm-material interactions

  13. Modified from O’Toole et al., 2000 PhD Work:Biofilm Life Cycle

  14. What about long term? • What happens when a biofilm is present for long periods of time • Can we observe evolutionary change in a biofilm? • Does some kind of GASP-like phenotype occur in biofilms?

  15. Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. Growth Advantage in Stationary Phase. Log CFU/mL The GASP Phenotype Finkel and Kolter, 1999

  16. Aged cells outcompete younger, initially isogenic cells when mixed. Advantageous mutations are selected during incubation in stationary phase. To date, all experiments performed on planktonic cells or in stab cultures. Growth Advantage in Stationary Phase. Log CFU/mL The GASP Phenotype Biofilm GASP? Finkel and Kolter, 1999

  17. Competition-Invasion Assay • Day 1= 12 of 23 trials significant in favour of 22-day-old cells • Day 2= 21 of 24 trials significant in favour of 22-day-old cells • Box indicates titer error of  3 fold

  18. Overview • Brief Introduction • My background • Research at NIST • Today’s experiment

  19. Modified from O’Toole et al., 2000 NIST Research • How do biofilms respond to their substrate? Does substrate matter?

  20. Results: Decrease in Metabolic Activity at Low DC • Decrease in metabolic activity between 4 and 24 hrs • Greater decrease at 24 hrs on low DC polymers • Unpublished dad

  21. Live/Dead- Confocal 24hr UV treated

  22. Overview • Brief Introduction • My background • Research at NIST • Today’s experiment

  23. pGlo: GFP plasmid • pGlo is a plasmid • Circular DNA • Can be transformed into bacteria • Independently replicating • pGlo has Ampicillin Resistance • GFP on the plasmid is inducible by arabinose

  24. Transformation • Def: inserting a plasmid into a bacterial cell • Two methods • Heat Shock • Electroporation • Mechanism unknown • Bacteria must have a reason to keep the plasmids (ex. Drug resistance = benefit)

  25. Genes at work • pGlo DNA is NOT fluorescent • Only when the plasmid is transformed into the bacteria can fluorescence be observed • Bacteria’s cellular machinery takes the DNA coding for GFP, makes mRNA, then the Green Fluorescent Protein. • The GENE is NOT fluorescent, the PROTEIN IS fluorescent. Transcription Translation DNA mRNA Protein

  26. Inducible Gene Expression • When you want total control • Turn genes on or off with an external control (ex. Arabinose) • Arabinose is a sugar • GFP is under the control of a tightly regulated system on the plasmid. GFP will only be turned on when arabinose is present.

  27. Procedure • Walk through general procedure • The full manual has a lot of good information and discussion points

  28. Results

  29. Results AmpR = Cells have plasmid Have GFP gene, but not turned on Negative Control Positive Control No growth Lawn of cells

  30. Plasmid sequence with GFP • 5-AGATTGCAGCATTACACGTCTTGAGCGATTGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGTAAGTTACTGAAGAATTCGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCCGGGTACCTAGAATTAAAGAGGAGAAATTAAGCGCTCATATGCGGAATTCGCTAGTTCTCATATGGACCATGGCTAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTGAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCGGATCTTGCGGCCGCAAAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGCATCGATGGCCCCCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTGGCCAGTGCCAAGCTTGCATGC

More Related