1 / 13

Understanding DNA to Protein Synthesis Process

Learn how DNA encodes proteins, the role of RNA in translation, and the importance of amino acids in creating proteins. Explore concepts like transcription, translation, mutations, and amino acid chains.

kessie-garrett
Télécharger la présentation

Understanding DNA to Protein Synthesis Process

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The Purpose of DNA • To make PROTEINS! • Proteins give us our traits (ex: one protein gives a person blue eyes, another gives brown Central Dogma of Molecular Biology DNA mRNA Protein • How do we get from DNA to proteins? • Through RNA! • RNA—Ribonucleic Acid • Has Ribose sugar instead of Deoxyribose and is single-stranded instead of double stranded • mRNA—messenger RNA • tRNA—transfer RNA • rRNA—ribosomal RNA

  2. Transcription • DNA mRNA DNA bases mRNA bases Adenine Adenine Guanine Guanine Cytosine Cytosine Thymine Uracil

  3. Write the Complimentary RNA Strand to the DNA strands below • ATGCGGATACATCCGATCGATGCAAT • TGACGGACACTTACAGATTCTGTGAG • GAGCATTAGCAGGACTGCACGATATT • GTAGTAGTAGTAGTAGTAGTAGTAGT

  4. Transcription Review • DNA mRNA

  5. Translation • mRNA Proteins • mRNA travels to the Ribosomes, where it is translated into AMINO ACIDS • mRNA is read in groups of 3-nucleotides called Codons • AUG = 1 codon • CAU = 1 codon

  6. Each codon codes for 1 amino acid, which is matched by a tRNA molecule. • The tRNA translates the message from mRNA into a specific chain of amino acids

  7. Codon Wheel of Amino Acids

  8. A chain of amino acids = 1 protein • The order of the amino acids determines the type of protein created

  9. Amino Acids • Essential Amino Acids—We have to obtain from food • Isoleucine • Leucine • Lysine • Methionine • Phenylalanine • Threonine • Tryptophan • Valine • Non-Essential Amino Acids—body produces • Alanine • Aspargine • Aspartic Acid • Cysteine • Glutamic Acid • Glutamine • Glycine • Proline • Serine • Tyrosine • Arginine • Histidine

  10. Construct the amino acid chain from the following mRNA strands • AUGCGGAUACAUCCGAUCGAUGCAAUCAUGCAU • AUGCGGACACUUACAGAUUCUGUGAGUCUCAAC

  11. Transcribe the following DNA sequence to mRNA, divide into triplet codons, then translate the sequence to Amino Acids. TACGATGCCATGCTGAGCTTGACCGCATCTAGGACTATGCA

  12. DNA Mutations • Point Mutation • Substitution of a single base • AUG CUG GAA CGA CUG UGA • AUG CUG GAG CGA CUG UGA • Frameshift Mutation • Insertion or deletion of a single base • AUG CUG GAA CGA CUG UGA • AUG CUG AAC GAC UGU GA • OR • AUG CUG GUA ACG ACU GUG A

More Related