1 / 18

Implementing computational analysis through Web services

Implementing computational analysis through Web services. Arnaud Kerhornou CRG/INB Barcelona - BioMed Workshop IRB November 2007. Current situation in Bioinformatics. Limits. Discovery Service description Ontologies Data transfert Automation. BioMoby architecture.

kim
Télécharger la présentation

Implementing computational analysis through Web services

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Implementing computational analysis through Web services Arnaud Kerhornou CRG/INB Barcelona - BioMed Workshop IRB November 2007

  2. Current situation in Bioinformatics

  3. Limits • Discovery • Service description • Ontologies • Data transfert • Automation

  4. BioMoby architecture Service Descriptions A web service is an interface that describes a collection of operations that are network accessible through standardized XML messaging Service registry Find Publish WSDL, UDDI WDSL, UDDI Service Description Service Bind Service Requestor Service Provider

  5. BioMobya unifying framework approach • The bioMoby project aims to provide bioinformatics resources through the web. It can be data retrieval resources or analysis resources. • It defines an ontology-based messaging standard • The services are registered in a central “yellow pages” server to facilitate the discovery • The services specifications are formalized in a description language.

  6. The BioMoby framework It provides: • A Central Registry of services • A set of standards to specify: • Message formatting, • Error reporting • Asynchronous requests • An API written in two languages, perl and java • Ontologies to represent • Types of services, • Data types

  7. Ontology • Data exchange relies on the use of Ontologies. • Ontology to represent knowledge in a given domain • In bioinformatics: • OBO (GO, SO and many many more) • http://obo.sourceforge.net/cgi-bin/table.cgi • Biomoby datatypes to classify service input/output • Biomoby service types

  8. The BioMoby ontologies Establish Ontologies to formalize the representation of: • Types of services • Types of data

  9. The Service TypeOntology SequenceAnalysis GeneFinding Service Bioinformatics PairwiseSequenceAlignment is-a Alignment MultipleSequenceAlignment

  10. The Data TypeOntology has-a String GFF text_formatted text_plain is-a has-a Object AminoAcidSequence is-a VirtualSequence GenericSequence has-a Integer DNASequence

  11. Moby DNASequenceObject <DNASequence> <String articleName=”Sequence”> AAATGTCGCTCGATACGATCAGCTACGA </String> <Integer articleName=”Length”> 28 </Integer> </DNASequence>

  12. BioMobyService specs • Service name: Free Text • Service type: Moby service type ontology • Description: Free text • One or more inputs: Moby data type ontology • One or more outputs: Moby data type ontology • One or more parameters: • name (a string) • value (an ‘primitive’, ie a String or an Integer etc.)

  13. Example RunGeneIDGFF service specifications: • Service type: GeneFinding • Description: ab-initio gene finding software • Input: a DNASequence object • Output: a GFF object • Parameters: • Profile (Default is Human) • Strand (Default is both strands)

  14. Client Side • There are different kind of clients • Some of them allow the creation of workflows Programmatic libraries:

  15. Client Side: Taverna I • Java based graphical integrated workbench • It allows the construction of complex distributed workflows • It can handle different kind of services (Moby and others)

  16. Client Side: Taverna II Processors = Webservices Inputs Outputs

  17. Client Side: Taverna III Moby Web service Configuration

  18. BioMoby on the Web • All the info accessible at the Moby homepage at: • http://www.biomoby.org/ • Taverna Web site • http://www.inab.org/MOWServ • Remora Web interface • http://lipm-bioinfo.toulouse.inra.fr/remora/cgi/remora.cgi • MowServ Web interface • http://www.inab.org/MOWServ/ • Genome Analysis services page • http://genome.imim.es/webservices

More Related