130 likes | 294 Vues
Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319 . Brandon Ramirez Serge Marraback. Source Organism. Prochlorococcus marinus str. MIT 9313 These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth.
E N D
Cloning Antifreeze gene from Prochlorococcusmarinus str. MIT 9319 Brandon Ramirez Serge Marraback
Source Organism • Prochlorococcusmarinus str. MIT 9313 • These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth. • Prokaryotes • No Introns • Currently in contact with MIT (Chisholm Laboratory) for organism
Growing • ProchlorococcusMarinus-cultures have been isolated and maintained in natural seawater-based media. The compositions of which have evolved over the years • They differ in a number of ways, primarily with respect to the type and concentration of the macronutrients and metal chelators.
GOI: PMT1149 • Accession #: NP_894980 • GI: 33863420 • 372 bp, 124 aa • Responsible for the production of a Type I antifreeze protein
Antifreeze Proteins • There are 4 known Antifreeze proteins • Type I, Type II, Type III and Type IV • Structure differs by type • The 4 known types evolved independently. • Function is the same in all types • To bind to ice crystals and inhibit growth • Has multiple repeat regions of (Threonine-alanine(or Proline)-alanine)
DNA Sequence & Primers with BioBricks gaattcgcggccgcttctagatggcgtatccggaaagcca 5’ 3’ atggcgtatccggaaagccaggtggtgatgggcggcctggtgcatattccgattattattggcgtgttttgggcgctgaacaacctgaccaccggcggcagcaaagcgaaaaaagcggcggaagcgcaggcgaaacaggcggcggaagaagcggcggcgaaagcggcggcggaagcggcggcgaaacaggcggcggaacaggcggcggcgaaagcggcggcggaagcggcggcggcgaaaaaagcggcggaagcggcggcgagcgcggcgccggcggcgaccgcggcgaccccggtgagcggcgaagcggaaaccagccaggcgagcaacaacgatacccaggcgaccccggcgccggatcaggaagtgctg • No Introns (Prokaryote) and no restriction sites in code 3’ gcggcctagaccttcacgtctactagtagcggccgctgcag 5’
Vector & Regulator • Vector: pSB2K3 • Resistance to Kanamycin
Promoter • First choice: BBa_K360041 • Minimum blue light promoter • Weak promoter • ycgF receptor is responsive to blue light, when struck with blue light it dimerizes and binds to the ycgE repressor releasing the repressor from the promoter. • Backups: • BBa_I0500 • Pbad • Inducible by L-arabanose • BBa_K258005 • Oxygen Promoter-Vitreoscilla hemoglobin(VHb) promoter in E. coli.
Interface • Cut into vector at SpeI restriction enzyme site on plasmid • Suffix of plasmid ……tactagtagcggccgctgcag ……atgatcatcgccggcgacgtc • Cut at XbaI restriction enzyme on biobrick • Prefix & Suffix of biobrick gaattcgcggccgcttctaga-GENE-tactagtagcggccgctgcag gttaagcgccggcgaagatct-GENE-atgatcatcgccggcgacgtc • Ligate • ……tactaga-GENE-tactagtagcggccgctgcag • ……atgatct-GENE-atgatcatcgccggcgacgtc
testing • Testing for freezing point depression • The possibility of lowering the freezing temperature of E. Coli • E. Coli begins to die around -18 Celcius (0 Farenheit) • With Antifreeze protein we will see if this point of cell death can be lowered • The gene will be tested for by SDS-PAGE • 12.06 kD
References • http://www.aslo.org/lomethods/free/2007/0353.pdf • http://www.ncbi.nlm.nih.gov/protein/NP_894980 • http://www.pnas.org/content/94/8/3811.long