lani
Uploaded by
21 SLIDES
603 VUES
220LIKES

Isaiah 40:4, 5

DESCRIPTION

Isaiah 40:4, 5 4 Every valley shall be exalted, and every mountain and hill shall be made low: and the crooked shall be made straight, and the rough places plain: 5 And the glory of the LORD shall be revealed, and all flesh shall see it together: for the mouth of the LORD hath spoken it.

1 / 21

Télécharger la présentation

Isaiah 40:4, 5

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Isaiah 40:4, 5 4 Every valley shall be exalted, and every mountain and hill shall be made low: and the crooked shall be made straight, and the rough places plain: 5 And the glory of the LORD shall be revealed, and all flesh shall see it together: for the mouth of the LORD hath spoken it.

  2. Getting MeaningFromMolecular Data Timothy G. Standish, Ph. D.

  3. What are Genes? • The one-gene, one-enzyme hypothesis has been refined to mean each gene codes for a polypeptide • Things get fuzzy when a specific locus codes for more than one polypeptide • For the purposes of this class, we will define genes as segments of DNA that are transcribed and associated regions that control their transcription • Genes may code for both polypeptides or RNAs

  4. Determination of Gene Numbers • DNA sequences are considered to be the gold standard for determining the number of genes in an organism’s genome • The problem is that most organisms have un-sequenced genomes and, even when genomes are sequenced, deciding if a segment of DNA represents a region that is transcribed can frequently be difficult • Searching DNA for open reading frames seems to be the most logical way of finding genes, but just because an open reading frame exists does not definitively answer whether it is transcribed

  5. Indirect Estimates • DNA hybridization etc.

  6. Denaturation and Renaturation Denatured DNA Renaturation Denaturation HEAT ATGAGCTGTACGATCGTG ATGAGCTGTACGATCGTG ATGAGCTGTACGATCGTG TACTCGACATGCTAGCAC TACTCGACATGCTAGCAC TACTCGACATGCTAGCAC Double-stranded DNA Double-stranded DNA Single-stranded DNA • Heating double-stranded DNA can overcome the hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA • When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures

  7. Denaturation and Renaturation ACGAGCTGCACGAGC ATGATCTGTAAGATC TGCTCGACGTGCTCG TACTAGACATTCTAG 67 % GC content - 33 % GC content - ATGAGCTGTCCGATC TACTCGACAGGCTAG 50 % GC content - • DNA with a high guanine and cytosine content has relatively more hydrogen bonds between strands • This is because for every GC base pair 3 hydrogen bonds are made while for AT base pairs only 2 bonds are made • Thus higher GC content is reflected in higher melting or denaturation temperature High melting temperature Low melting temperature Intermediate melting temperature

  8. Determination of GC Content • Comparison of melting temperatures can be used to determine the GC content of an organisms genome • To do this it is necessary to be able to detect whether DNA is melted or not • Absorbance at 260 nm of DNA in solution provides a means of determining how much is single stranded • Single-stranded DNA absorbs 260 nm ultraviolet light more strongly than double-stranded DNA does, although both absorb at this wavelength • Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single- stranded DNA

  9. Determination of GC Content 1.0 Single- stranded DNA Relatively low GC content Relatively high GC content OD260 Tm = 75 oC Tm = 85 oC Double- stranded DNA 0 65 70 75 80 85 90 95 Temperature (oC) Tm is the temperature at which half the DNA is melted

  10. GC Content Of Some Genomes Organism % GC Homo sapiens 39.7 % Sheep 42.4 % Hen 42.0 % Turtle 43.3 % Salmon 41.2 % Sea urchin 35.0 % E. coli 51.7 % Staphylococcus aureus 50.0 % Phage l 55.8 % Phage T7 48.0 %

  11. Hybridization • The bases in DNA will only pair in very specific ways, G with C and A with T • In short DNA sequences, imprecise base pairing will not be tolerated • Long sequences can tolerate some mispairing only if -G of the majority of bases in a sequence exceeds the energy required to keep mispaired bases together • Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form a double helix as long as their sequences are compatible • Thus, this phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources

  12. Hybridization DNA from source “X” CTGATGGTCATGAGCTGTCCGATCGATCAT TACTCGACAGGCTAG Hybridization TACTCGACAGGCTAG DNA from source “Y”

  13. Hybridization • Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA using single-stranded DNA of known sequence • Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: • Southern blots • Northern blots (in which RNA is probed) • In situ hybridization • Dot blots . . . • In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes

  14. Reassociation Kinetics • An organism’s DNA can be heated in solution until it melts, then cooled to allow DNA strands to reassociate forming double-stranded DNA • This is typically done after shearing the DNA to form many fragments a few hundred bases in length • The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bump into one another and hybridize • Reassociation follows second order kinetics

  15. Reassociation Kinetics Concentration of single-stranded DNA after time t Co (measured in moles/liter) x t (seconds). Generally graphed on a log10 scale. C Co 1 1 + kCot = Initial concentration of single-stranded DNA Second order rate constant (the important thing is that it is a constant) • The following equation describes the second order rate kinetics of DNA reassociation: Cot1/2 is the point at which half the initial concentration of single- stranded DNA has annealed to form double-stranded DNA

  16. Reassociation Kinetics 1.0 Fraction remaining single-stranded (C/Co) 0.5 Cot1/2 0 10-4 10-3 10-2 10-1 1 101 102 103 104 Cot (mole x sec./l) Higher Cot1/2 values indicate greater genome complexity

  17. Reassociation Kinetics 1.0 Prokaryotic DNA Fraction remaining single-stranded (C/Co) Repetitive DNA Unique sequence complex DNA 0.5 Eukaryotic DNA 0 10-4 10-3 10-2 10-1 1 101 102 103 104 Cot (mole x sec./l)

  18. Repetitive DNA Organism % Repetitive DNA Homo sapiens 21 % Mouse 35 % Calf 42 % Drosophila 70 % Wheat 42 % Pea 52 % Maize 60 % Saccharomycetes cerevisiae 5 % E. coli 0.3 %

  19. The Globin Gene Family a b Fe b a • Globin genes code for the protein portion of hemoglobin • In adults, hemoglobin is made up of an iron containing heme molecule surrounded by 4 globin proteins: 2 a globins and 2 b globins • During development, different globin genes are expressed which alter the oxygen affinity of embryonic and fetal hemoglobin

  20. Model For Evolution Of The Globin Gene Family Ancestral Globin gene Duplication Mutation a b Transposition Chromosome 16 Chromosome 11 a b Duplication and Mutation z a e g b Duplication and Mutation a2 a1 yz ya2 yq ya1 z Gg yb Ag e d b Embryo Fetus and Adult Embryo Fetus Adult Pseudogenes (y) resemble genes, but may lack introns and, along with other differences typically have stop codons that come soon after the start codons.

  21. The End

More Related