1 / 23

Data Visualization

Data Visualization. Lecture 15 Information Visualization : Part 3. Visualizing Web Searches. www.kartoo.com. Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application Bases are: GCAT. Sequence Visualization. Thanks to Netta Cohen

leann
Télécharger la présentation

Data Visualization

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Data Visualization Lecture 15 Information Visualization : Part 3

  2. Visualizing Web Searches www.kartoo.com

  3. Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application Bases are: GCAT Sequence Visualization Thanks to Netta Cohen for these three slides

  4. Genome sequence is visualized by ‘walking’ in north (C), south (G), east (T) and west (A) directions, according to the base that is encountered Walk is not random, but we don’t understand all the rules Walking through the Genome

  5. value AGCTGCGAGTCGAGTTGGCA… Walking through the Genome in 1D A,G purines Ui = T,C pyrimidines Ui i

  6. Focus and Context • A recurring problem in Information Visualization is lack of screen real estate • Challenge has been addressed in some innovative ways • Want to achieve: • Focus: to see detail of immediate interest • Context: to see the overall picture

  7. Bifocal Display • Probably the first suggestion was the bifocal display of Spence and Apperley • Play Spence bifocal_lens movie

  8. Implemented as an image browser that scales different areas of image in different ways Chris North, Univ of Maryland Bifocal Display

  9. Transforming the information space to the display space Visual transfer functions cf colour transfer functions in scivis Display Space Display Space Information space Information space Bifocal display context focus What is the Bifocal Display Doing? Normal display

  10. Developing the Idea • Card, Robinson and McKinlay developed the idea into the ‘Perspective Wall’

  11. The Perspective Wall 2D layout wrapped around a 3D structure • Space utilisation: • detail on centre • panel 3x size of • equivalent flat • wall fitting field of • view

  12. Advantages: User can adjust ratio of detail to context Smooth animation helps user perceive object constancy Relationship between detail and context is consistent: objects bend around the corner Perspective Wall

  13. In terms of transfer function, the situation is closer to the early Spence movie Perspective gives smoother transition from focus to context Display Space Information space Perspective Wall Perspective Wall context focus

  14. Here is the same idea applied to menus Ben Bederson, University of Maryland See also: http://www.samuelwan.com/downloads/ com.samuelwan.eidt/fisheyemenu/ FisheyeMenuDemo.html FishEye Menus

  15. Research pages at University of Maryland include a nice applet that allows you to compare different menu styles Arrow bar Scroll Bar Hierarchical FishEye Screenshots on next slide created from: http://www.cs.umd.edu/ hcil/fisheyemenu/ fisheyemenu-demo.shtml Comparison of Menu Styles

  16. Menus hierarchical fisheye arrow scroll

  17. Question • Why is a magnifying glass no good for focus and context?

  18. Cone Trees • For large tree structures it is impossible to find sufficient screen space • Cone trees provide a solution • Here is a movie http://research.compaq.com/SRC/3D-animate/conetree.html

  19. Focus and Context for Volume Visualization • Marcelo Cohen is studying whether we can apply focus + context ideas to volume visualization

  20. Spence Attribute Explorer • Spence has also developed a tool called Attribute Explorer • Compare it with xmdvtool • Look for brushing concept • Here is the movie

  21. RSVP • Recent Spence work addresses problem of browsing information spaces • Rapid Serial Visual Processing • To gain a quick view of what is available • Distinction between browsing and searching • Here is the movie

  22. Browsing the Web • Spence has also turned his attention to browsing the web • On mobile devices! • Here is the movie

  23. Acknowledgements • The movies were taken from Bob Spence’s Web Site at Imperial College

More Related