MOL8002 – Molecular mechanisms of host defence

1. MOL8002 – Molecular mechanisms of host defence • Methods of molecular biology • Recognition of nucleic acids • hybridization, sequencing, PCR, arrays • Protein chemistry • some properties of monoclonal antibodies

2. Building blocks in DNA and RNA

3. DNA and RNA; Polymers of nucleotides formed by phosphodiester bonds between the 3’- carbon atom in one nucleotide and the 5’ carbon atom in another nucleotide. By this bond formation the string of bases are ordered in a direction and the sequence can contain information.

4. Base-pairing in double stranded DNA Two complimentary and anti-parallel (with opposite directions) DNA strands can form a stable double stranded DNA, where the strands form a double helix. The DNA in our genomes usually are on this form.

5. Nucleic acid hybridization hybridization Almost all specific recognition of a particular DNA (or RNA) sequence (used in sequencing, PCR, Southern- and Northerns etc.) is based on DNA (or RNA) hybridization where the complimentary sequence is used The hydrogen bonds between the two strands in a DNA-helix can be broken by increasing the temperature The melting temperature for a complimentary strand is determined primarily by the C/G versus the A/T content. The melting temperature for a short (<20 nucleotides) DNA-strand (oligonucleotide, “probe”, “”primer”) can Be calculated by the empirical formula: Tm ( C) = 4 x (# C/G) + 2 x (#A/T) o 3’ 5’ ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC TGCAATTGCTAAGACATCAGATTCCGAGCTTACG 3’ 5’ 5’ ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC - 3’ 3’ - TGCTAAGACATCAGATTCCG - 5’ o E.g. Tm ~ 4 x 9 + 2 x 11 = 58 C By using a temperature just below the melting temperature the oligonucleotide will not bind any other sequences.

6. The synthesis of a complementary strand by DNA and RNA polymerases • requires; • a template • nucleotides (dNTPs, NTPs) • a free 3’-OH group on a primer

7. DNA sequencing Dideoxy (Sanger) sequencing

8. Dideoxy-sequencing in one reaction applying fluorescent labeled ddNTPs and capillary electrophoresis

12. Pyro-sequencing

14. Pyro-sequencing, sequencing by synthesis • Nucleotides are flowed sequentially in a fixed order over a PicoTitre plate • When a nucleotide complementary to the nucleotide in the template strand comes • the polymerase incorporate the nucleotide releasing pyrophosphate • In an enzymatic reaction the pyrophosphate release generate light in that well • which is recorded by a CCD camera • The signal strength is proportional to the number of nucleotides incorporated • Sequencing is done in parallel with hundred of thousands of wells each containing • a unique bead with millions of copies of a unique ssDNA template

15. Typically for pyro-sequencing and many other modern molecular biology techniques are that automation and massive parallel processing (multiplexing) Illumina array technology

16. Method requires software tracing the localization of beads and analyzing Images from each localization By applying such machines it is now possible to sequence about one human genome (3 billion bases) in 3 days

17. Gene expression arrays

19. Gene expression arrays

21. Hierarchical-clustering analysis and data display of gene-expression patterns for a set of 80 human tumor samples. Each row represents a gene, and each column represents a tumor sample. Courtesy Charles M. Perou

23. PCR reactions can be done in real time by measuring amount of product as it is made, and can be used quantitatively

25. Recognition of epitopes (on protein) by antibodies

27. Protein recognition - antibodies

29. R + H RH BINDING STRENGTH OF HORMONES OR ANTIBODIES TO CELL SURFACE RECEPTORS (OR ANTIGENS) Antigens or cell surface receptors (R) bind antibody or ligand (H) with high affinity and specificity The binding can be quantitied by having a label on the ligand (or the antibody). The receptor/ ligand interaction can be described by the equation: where R is the concentration of free receptors and H of unbound ligand at equilibrium, and RH is the concentration of the complex. The association constant is defined by: Ro is the number of binding sites Ka = ( [ Ro ] - [ RH ] ) = Ka ( [ Ro ] - [ RH ] ) = Plotted as a Scatchard plot which gives the Ka (slope of the curve) and the total number of binding sites, Ro, when = 0 [ Ro ] [ RH ]

30. Antibody binding characteristics by surface plasmon resonance Human Combinatorial Antibody Library - HuCAL

33. Luminex technology for immunoassays; • Hundred different beads (with 100 unique colors), • each bead bound to an unique antibody • Beads mixed and allowed to react with antigens • Antigens on beads detected by a mixture of • specific antibodies with one type of fluorescent label

34. Trends • Many technological developments in biology are based on; • relatively simple biochemical reactions • miniaturization and automation • parallel processing • requires advanced data handling and storage • Many technological developments in biology are based on; • advanced understanding of biological mechanisms • transgene and animals • viral transduction of genes Results are cost increase and large scale approaches (”systems biology”). However, I think many of the really interesting experiments still can be done at relatively low cost in simple laboratories (i.e. at the “kitchen bench”)