220 likes | 624 Vues
BP Reaction. LR Reaction. Gateway cloning system. Why Gateway. No restriction enzymes needed Fast High efficiency Multiple destination vectors Site-directed mutagenesis (Empty donor vector is very small ~2.3kb). 1. Design the primers. attB1(Foward): GGGGACAAGTTTGTACAAAAAAGCAGGCT TC
E N D
BP Reaction LR Reaction Gateway cloning system
Why Gateway No restriction enzymes needed Fast High efficiency Multiple destination vectors Site-directed mutagenesis (Empty donor vector is very small ~2.3kb)
1. Design the primers attB1(Foward): GGGGACAAGTTTGTACAAAAAAGCAGGCTTC attB2(Reverse) GGGGACCACTTTGTACAAGAAAGCTGGGTC
2. BP reaction PCR product need to be recovered from gel. Important! PCR product 4.0ul pDONR/Zeo 0.5ul BP clonase 0.5ul O/N at R/T LB+Zeocin (Half salt)
3. Sequencing PCR product+donor vector=Entry clone Pick 1-2 colonies (no colony PCR needed) M13f and M13r are used to sequence cloned fragment
4. LR Reaction Entry clone 1ul Destination vector 1ul LR clonase 0.5-1.0ul TE buffer/H2O 2.0-2.5ul 1 hour at R/T
5. Destination clones Bacterial selection=destination vector After plasmid isolation, run a gel. Sometimes entry vector will be co-transformed. Make sure there is no bright band of entry vector. Colony PCR if necessary.
Gateway compatible destination vector construction Insert Gateway cassette in to target Vector. Three cassettes with corresponding three different reading frames. Decide which one you need. Consider N-/C-terminal fusion. Blunt ligation. You need check the cassette orientation. Bacterial selection: chloramphenicol+X You can only use ccdB survival strains.
Currently available destination vectors pBASTA-35S-GFP-GW pBASTA-35S-FLAG-GW pHYG-35S-GFP-GW pTA7002-GW pBASTA-GUS-GW pGTB9BS-GW (New) pGAD GH-GW (New) pGEMHE-GW (New) pGEX4T-3-GW