250 likes | 359 Vues
Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni Dirk Redecker Todd DeSantis Teun Boekhout Barbara Robbertse Irina Druzhinina. Fungal Barcoding. John W. Taylor University of California Berkeley, USA. Barcoding fungi is a great idea.
E N D
Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni Dirk Redecker Todd DeSantis Teun Boekhout Barbara Robbertse Irina Druzhinina
Fungal Barcoding John W. Taylor University of California Berkeley, USA
Barcoding fungi is a great idea. The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown. Ecology and its applications would benefit tremendously. http://www.barcode.it/
Barcoding fungi is a great idea. The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown. Ecology and its applications would benefit tremendously. http://www.barcode.it/
Barcoding fungi is a great idea. The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown. Ecology and its applications would benefit tremendously. http://www.barcode.it/
Cytochrome Oxidase I is not the right gene for fungal barcoding. From the barcoding website: http://www.dnabarcoding.ca/primer/Primers.html PRIMERS Overview In order to obtain barcode sequences from such a broad spectrum of animal taxa, researchers require an arsenal of primer sets.
Cytochrome Oxidase I is not the right gene for fungal barcoding. From the barcoding website: http://www.dnabarcoding.ca/primer/Primers.html PRIMERS Overview In order to obtain barcode sequences from such a broad spectrum of animal taxa, researchers require an arsenal of primer sets.
If Cytochrome Oxidase I requires an arsenal of primers, how can it work for any group of organisms?
Macrobes v. Microbes Macrobes: Phenotype is available in museums or herbaria, zoos or gardens, and nature. Taxa are well sampled. Microbes: Phenotype is available in herbaria and culture collections but NOT in nature. Taxa are poorly sampled.
www.livescience.com Ward et al. (2005) amplified COI from more than 200 fish using different combinations of four newly designed primers: FishF1-50TCAACCAACCACAAAGACATTGGCAC30, FishF2-50TCGACTAATCATAAAGATATCGGCAC30, FishR1-50TAGACTTCTGGGTGGCCAAAGAATCA30, FishR2-50ACTTCAGGGTGACCGAAGAATCAGAA30. However, there was insufficient product from five species, necessitating the use of an additional forward primer: (50ATCTTTGGTGCATGAGCAGGAATAGT30)
Ward et al. (2005) amplified COI from more than 200 fish using different combinations of four newly designed primers: FishF1-50TCAACCAACCACAAAGACATTGGCAC30, FishF2-50TCGACTAATCATAAAGATATCGGCAC30, FishR1-50TAGACTTCTGGGTGGCCAAAGAATCA30, FishR2-50ACTTCAGGGTGACCGAAGAATCAGAA30. However, there was insufficient product from five species, necessitating the use of an additional forward primer: (50ATCTTTGGTGCATGAGCAGGAATAGT30) FIVE PRIMERS FOR FISH
http://www.botany.utoronto.ca/ResearchLabs/MallochLab/Malloch/Mouldshttp://www.botany.utoronto.ca/ResearchLabs/MallochLab/Malloch/Moulds Seifert et al. (2007). We tested the performance of PenF1 with both PenR1 and AspR1 in PCR amplifications using genomic DNA isolated from ten species of the family Trichocomaceae, PCR amplications using PenF1 and PenR1 were sporadically successful, whereas amplications using AspR1 had a 100% success rate. Aspergillus and Penicillium subgenus Penicillium are closer relatives than either is to Penicillium subgenus Biverticillium.
New Fungi In Tundra Soils Schadt et al. 2003
New Fungi In Tundra Soils Schadt et al. 2003
New Fungi In Tundra Soils rDNA sequences Schadt et al. 2003
Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni Dirk Redecker Todd DeSantis Teun Boekhout Barbara Robbertse Irina Druzhinina
Barcoding Decapods (Crustacea) Costa et al. 2007 Forward primers: LCO1490 Crust F1 and Crust F2 (Costa et al. 2007). Reverse primer: HCO2198 (Folmer et al. 1994).