'Primers' diaporamas de présentation

Chapter 13: DNA Technology

Chapter 13: DNA Technology. 13-1 The New Genetics. 13-2 DNA Technology Techniques. 13-3 Practical Uses of DNA Technology. 13-1 Chromosomes and Inheritance. I. Manipulating Genes (base sequences). Genes must be IDENTIFIED and ISOLATED before INSERTED from one cell type to another.

1.15k views • 96 slides

Chapter 13: DNA Technology

Chapter 13: DNA Technology. 13-1 The New Genetics. 13-2 DNA Technology Techniques. 13-3 Practical Uses of DNA Technology. 13-1 Chromosomes and Inheritance. I. Manipulating Genes (base sequences). Genes must be IDENTIFIED and ISOLATED before INSERTED from one cell type to another.

1.11k views • 96 slides

Outbreak of E. coli O104:H4 heralds a new paradigm in responding to disease threats

Outbreak of E. coli O104:H4 heralds a new paradigm in responding to disease threats. Nicola J. Holden Leighton Pritchard. EHEC O104:H4 outbreak, Europe 2011. Unprecedented: scale of outbreak (3950 affected, 53 deaths; multiple import restrictions)

380 views • 26 slides

356 views • 25 slides

How are genetically modified organisms created?

How are genetically modified organisms created?. Bacteria Yeast Animals Worms Flies Mammals Plants. Ways of inserting foreign DNA into cells. Engineering E. coli to produce a foreign protein. Synthesis of cDNA using reverse transcriptase.

360 views • 24 slides

Romans 5:17

483 views • 22 slides

Romans 5:17

374 views • 22 slides

Genome closure and finishing

Genome closure and finishing. Clone walking. clone insert (from shotgun library). primer locations. Already sequenced. Unsequenced. sequencing primer. direction of extension. tgcatgatcgtgatcat acgtactagcactagtactgtagtcgatgcactgatcgatcgatcgatgctacgatgcatgct. PCR to close gaps. Scaffold.

296 views • 21 slides

Analysis of Xbp-mRNA

183 views • 15 slides

MOLECULAR SCREENING OF MHC RESISTANCE GENES IN WEST AFRICAN DWARF GOATS

Investigation Team: Prof. C.O.N. Ikeobi , Prof. M.O. Ozoje , Dr. A.O. Talabi , Dr. M. Okpeku and Dr. I.G. Imumorin PRESENTED BY Prof. C.O.N IKEOBI Department of Animal Breeding and Genetics, College of Animal Science and Livestock Production.

312 views • 15 slides

Analysis of Ancient Human DNA and Primer Contamination

Analysis of Ancient Human DNA and Primer Contamination . By: Ashneet Biln , Raelene Knight & Shauna Maracle. Overview. Introduction to Mitochondrial DNA Article Overview Primers PCR positive and negative controls Results Contamination Conclusion . Mitochondrial DNA.

263 views • 14 slides

Unit 1 Making a Living in the Wild

Unit 1 Making a Living in the Wild. Chapter 9 Part 1 Communication. Communication. Sender sends signal to receiver Receiver responds in some way Leads to an advantage to sender Can also be advantage to receiver w/o intention. Channels of communication. Sound Visual Touch Smell

209 views • 12 slides

AtMYB80 (0.0321)

AtMYB102 (0.1546). AtMYB74 (0.1371). AtMYB41 (0.2087). AtMYB32 (0.1934). AtMYB4 (0.1944). Os12g07640 (0.2380). AtMYB80 (0.0321). BnMYB80 (0.0308). GhMYB80 (0.1860). OsMYB80 (0.0838). TaMYB80 (0.0791). AtMYB35 (0.3191). Os03g18480 (0.3100). Os02g42870 (0.2969).

157 views • 6 slides

Bioinformatics Program

154 views • 5 slides

COX-2

Supplemental Figure2. COX-2 expression in meningioma and colon cancer. B. A. D. C. E. Supplemental Figure 2. COX-2 expression in meningioma and colon cancer .

204 views • 2 slides

Supplemental Figure 1

Supplemental Figure 1. a. Relative expression. b. Relative expression. c. Relative expression.

90 views • 1 slides

RAD54 Primers ( S. cerevisiae gene)

PCR controls. RAD54 -T2 RAD54 -T2 WT WT Plasmid GDNA No DNA. + - + - + - + -. RAD54 Primers ( S. cerevisiae gene). Actin Primers ( A. thaliana gene).

131 views • 1 slides

Supplementary Table 1 . List of primers used for real-time PCR analysis

Supplementary Table 1 . List of primers used for real-time PCR analysis. --------------------------------------------------------------------------------------------------------------------------------------- Gene Forward primer Reverse primer

238 views • 1 slides

bcr2776-S1

Additional file 1: Sequences of primers used to amplify region surrounding each mutation analyzed in the study.

108 views • 1 slides

Supplemental Table 1

Supplemental Table 1.

174 views • 1 slides