1 / 15

Analysis of Xbp-mRNA

Analysis of Xbp-mRNA. RT-PCR. Polymerase Chain Reaction (PCR). Reverse Transcription of Target RNA . Uses “downstream or “right primer” Extends from target right end (3’) to left end (5’) Uses DNA nucleotides Creates a “First Strand” of cDNA

artie
Télécharger la présentation

Analysis of Xbp-mRNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Analysis of Xbp-mRNA RT-PCR

  2. Polymerase Chain Reaction (PCR)

  3. Reverse Transcription of Target RNA • Uses “downstream or “right primer” • Extends from target right end (3’) to left end (5’) • Uses DNA nucleotides • Creates a “First Strand” of cDNA • First strand is copied from left primer to give double stranded DNA

  4. Annealing of Downstream Primer to RNA

  5. Reverse Transcription With AMV Reverse Transcriptase

  6. RNA Copied From 3’ to 5’ into cDNA

  7. Amplification of cDNA by PCR

  8. Promega Access RT-PCR Cycles

  9. Designing Primers for RT-PCR for Xbp-1 mRNA Analysis • Criteria • Must bracket target sequence in mRNA • Must be at least 17 NT long • Must have a G+C content of ≈ 50-60% • Should have 5’ “GC clamp” • Should not dimerize • Should not form hairpin structures

  10. WormBase Sumary for xbp-1 gene • Brief ID: xbp-1 encodes a bZIP transcription factor orthologous to yeast Hac1 and mammalian X box-binding protein 1 (XBP-1, OMIM:194355); XBP-1 is required for the unfolded protein response (UPR) that counteracts cellular stress induced by accumulation of unfolded proteins in the endoplasmic reticulum (ER); XBP-1 mRNA is spliced by the IRE-1 endoribonuclease to promote translation of transcriptionally active XBP-1 that positively regulates UPR gene expression to maintain ER homeostasis and promote normal development. [details] • Species: Caenorhabditis elegansCommon name: xbp-1 (CGC approved) • Gene model(s): Gene ModelStatusRemarkNucleotides (coding/transcript)ProteinSwissProtAmino AcidsR74.3confirmed by cDNA(s)C. elegans XBP-1 protein; contains similarity to Interpro domains IPR004827 (Basic-leucine zipper (bZIP) transcription factor), IPR008917 ()795/1747 bpWP:CE01056Q22027264 aa

  11. Structure of xbp-1 Gene

  12. Analysis of Primers Left Primer #1 5’ GCAAAGAGAACGAACGACTGAATCAT GC%= 39.13 TM = 58.2 Forms 1 low stability dimer Left Primer #2 5’ GAACCAGAGAACGAGTCCG GC% =60 TM =60.39 No dimers Right Primer 5’ TGTTCGAGGGTCTCCATCTTCTT 3’ (Reverse compliment of sense strand) GC% = 45.45 TM = 58.09 Forms one low stability dimer

More Related