menefer
Uploaded by
16 SLIDES
323 VUES
160LIKES

Transcription vs. Translation

DESCRIPTION

Transcription vs. Translation. Making Proteins. Messenger RNA. Ribosomal RNA. Transfer RNA. Bring amino acids to ribosome. Combine with proteins. tRNA. mRNA. Carry instructions. rRNA. DNA. Ribosome. Ribosomes. Reviewing RNA. Section 12-3. RNA. can be. also called.

1 / 16

Télécharger la présentation

Transcription vs. Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription vs. Translation Making Proteins

  2. Messenger RNA Ribosomal RNA Transfer RNA Bringamino acids toribosome Combine with proteins tRNA mRNA Carry instructions rRNA DNA Ribosome Ribosomes Reviewing RNA Section 12-3 RNA can be also called which functions to also called which functions to also called which functions to from to to make up

  3. Transcription • RNA polymerase binds to DNA and separates the DNA strand. • Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA

  4. Transcription Section 12-3 Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNApolymerase DNA RNA

  5. How does RNA read DNA? • What is a codon? • Three nucleotides • How does the RNA know where to start? • DNA polymerase only binds to promoters • Specific codon that signifies the beginning of a sequence (AUG or methionine) • How does the RNA know when to stop? • Specific codons that signify the end of a protein chain (there are 3 of them)

  6. Transcription Video Click Here

  7. Transcription Activity • The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook: • DNA= TAC CGA TTA GCG ATG AGT AGA ACT • RNA= AUG GCU AAU CGC UAC UCA UCU UGA • Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop

  8. Transcription vs. Translation Making Proteins

  9. Messenger RNA Ribosomal RNA Transfer RNA Bringamino acids toribosome Combine with proteins tRNA mRNA Carry instructions rRNA DNA Ribosome Ribosomes Reviewing RNA Section 12-3 RNA can be also called which functions to also called which functions to also called which functions to from to to make up

  10. Reviewing Transcription • Making mRNA from Copying DNA • How is it different from DNA Replication?

  11. Translation • Cell uses information from mRNA to produce proteins • tRNA brings amino acids to the mRNA chain • Anticodon on tRNA binds to codon on mRNA • Amino Acids are bonded to each other in a process called elongation

  12. Section 12-3

  13. Translation Video Click HERE

  14. Activity • Transcribe and then Translate the following DNA code into a protein chain. • ATTACACCGCATATACTAAC

  15. Homework • Explain the entire process for creating a protein (transcriptions and translation) • Use the following DNA code to help you: • TCTACGCAAAGACCTTAGCATATAACACTTAG • Use pictures or drawings to illustrate what is happening in each step • Use the following vocab words: • RNA polymerase, Codon, Anticodon, Elongation, DNA, mRNA, tRNA, amino aicd, protein

More Related