Decoding the Genetic Blueprint: DNA, Transcription, Translation, and Protein Synthesis
Explore how DNA codes for proteins through transcription and translation processes. Discover the role of mRNA, tRNA, and ribosomes in protein synthesis, and learn how to decode the genetic information embedded in DNA to produce functional proteins.
Decoding the Genetic Blueprint: DNA, Transcription, Translation, and Protein Synthesis
E N D
Presentation Transcript
Drill – Biology! 1) Where is DNA stored in eukaryotes? Prokaryotes? 2)Can DNA leave the nucleus? If not, how does the genetic code get to the rest of the cell? 3) What molecules make up the “code” in DNA? 4) What molecules make up the “backbone” of DNA? 5) Why does everyone except monozygotic (identical) twins look different?
What does this mean? • Translate the following sentences into English: 1) La biología es el mejor tema (Biology is the best subject) 2) Digital Harbour tiene un olor raro (Digital Harbor has a weird smell) 3) Baltimore "La ciudad más grande en América" (Baltimore 'The Greatest City in America') • What would you need if you did not know Spanish to figure out these phrases? • What in your body (and in every living organism) needs to be decoded before it is useful?
Questions to be answered today • How do we get from the bases found in DNA to amino acids? • How do we get from a bunch of amino acids to proteins?
Transcription and Translation: An Overview (aka the Central Dogma) Transcription Translation
Video: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related
Protein Structure • Made up of amino acids • Polypeptide- string of amino acids • 20 amino acids are arranged in different orders to make a variety of proteins • Assembled on a ribosome So how do we make a complete protein?
It starts with…TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG GGG ACU UGC UAU
Transcription creates mRNA!!! • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus
Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?
Now we get to Translation!!! • Here we actually CODE for amino acids! • Second stage of protein production • mRNA is on a ribosome
Translation • tRNA brings amino acids to the ribosome
tRNA • Transfer RNA • Bound to one amino acid on one end • Anticodon on the other end complements mRNA codon
tRNA Function • Amino acids must be in the correct order for the protein to function correctly • tRNA lines up amino acids using mRNA code
The Steps: Pages 208 - 209 • 1) Initiation: mRNA, tRNA and the ribosome come together (AUG codes for the START – Methionine) • 2) Elongation: tRNA brings the specific amino acids together forming a chain (repeats over and over)
The Steps • 3) Termination: Stop codon ends translation • 4) Disassembly: The ribosome falls apart and releases the protein
Reading the DNA code • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- coding triplet of mRNA bases
Example problem: • DNA: ATGGCCTAAGGT • RNA: UACCGGAUUCCA (transcription) Refer to table 10-1 on page 207 to find the amino acids (Translation) • UAC = • CGG = • AUU = • CCA = Tyrosine Arginine Isoleucine Proline
ACGATACCCTGACGAGCGTTAGCTATCG UGC GGG ACUG UAU
Class Work! • Complete the “Marshmallow Man” translation activity • When finished coding raise your hand to so I can check it and give you the materials! • Extra Credit – Create your own code using the letters ATGC. Then create a message and have another student attempt to translate it.
Exit Pass: 1) What did the marshmallow man represent in the activity? 2) List the steps needed to create a protein (amino acid chain) 3) How many mRNA molecules are read as a codon? a) 2 b) 3 c) 4 d) 5