180 likes | 250 Vues
Explore the flow of genetic information from DNA to protein, including transcription and translation processes. Learn about the role of RNA in gene expression and the importance of splicing for accurate protein synthesis.
E N D
From Gene to Protein How Genes Work
What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies
The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? RNA DNA protein trait
1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"
aa aa aa aa aa aa aa aa aa aa aa From gene to protein nucleus cytoplasm DNA mRNA protein trait
Transcription fromDNA languagetoRNA language
RNA • ribose sugar • N-bases • ____________________ • ____________________ • ____________________ • ____________________ • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA
Transcription • Making mRNA • transcribed DNA strand = ___________________ • enzyme • __________________________ 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53
Initiation • ________________________ • binding site before beginning of gene • __________________________________ • binding site for RNA polymerase
RNA polymerase Elongation A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U 5' 3' A G C C A T G G T A C A G C T A G T C A T C G T A C C G T
Termination • Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • ___________ = the real gene • expressed / coding DNA • ___________ = the junk • inbetween sequence eukaryotic DNA
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • ______________________________ • ______________________________ • edit out introns • ______________________________ ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes
Alternative splicing • _______________________________________ • when is an intron not an intron… • different segments treated as exons
3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • ________________________________ • ________________________________
aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait