olesia
Uploaded by
15 SLIDES
659 VUES
180LIKES

Mutation

DESCRIPTION

Mutation. Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca. Mutation. - any detectable change in DNA sequence eg. errors in DNA replication/repair. inherited ones of interest in evolutionary studies. Deleterious. - will be selected against and lost ( purifying selection ).

1 / 15

Download Presentation
Télécharger la présentation

Mutation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Mutation Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca

  2. Mutation • - any detectable change in DNA sequence • eg. errors in DNA replication/repair • inherited ones of interest in evolutionary studies Deleterious - will be selected against and lost (purifying selection) Advantageous • will be fixed in population by natural selection • - rare occurrence Neutral • will have not effect on phenotype • - may be fixed in population by genetic drift

  3. Type of Mutations 1. Point mutations = purine to purine or pyrimidine to pyrimidine Transition Transversion = purine to pyrimidine How many possible transitions? transversions? p.38 “In animal nuclear DNA, ~ 60-70% of all point mutations are TRANSITIONS, whereas if random expect 33%”

  4. Types of mutations - different aa specified by codon Missense mutation Nonsense mutation - change from sense codon to stop codon Non-synonymous - amino acid altered Synonymous - “silent” change 2. Insertions or deletions (“indels”) - frameshift mutations within coding sequences Fig. 1.12

  5. Spontaneous Point Mutation Rates G – genome sizeµb – mutation rate per site per generationµg – genomic mutation rate per generation Table 4 in Drake et al. 1998, Genetics

  6. Slippage and Short Indels Short insertions or deletions (short “indels”) eg. if slippage during DNA replication • rapid evolution change in copy number • of short tandem repeats microsatellites Fig.1.18

  7. Normal and Thalassemia HBb 10 20 30 40 50 60 ----|----|----|----|----|----|----|----|----|----|----|----|-- Normal AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU Thalass. AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU ************************************************************** 70 80 90 100 110 120 --|----|----|----|----|----|----|----|----|----|----|----|---- Normal GGAUGAAGUUGGUGGU-GAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... Thalass. GGAUGAAGUUGGUGGUUGAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... **************** *************************************** • Are the two genes homologous? • What evolutionary change can you infer from the alignment? • What is the consequence of the evolutionary change?

  8. Synonymous mutation = silent mutation? Do you agree or disagree with the following statement? see p.27 “A synonymous mutation may not always be silent.” Fig. 6.23

  9. Triplet repeat disorder - increased copy number of tandem repeats of triplets within gene (or regulatory region) - certain human genetic (neurodegenerative) diseases - repeat number strongly correlates with age of onset of disease and severity DM1: Dystrophia myotonica-protein kinase, DMPK on Chr 19 DM2: ZNF9 gene on chromosome 3q21. HTT on chr 4q16.3 Repeat copy number in normal = red; orange = carrier; yellow = disease condition Gerald Karp 2007. Cell and Molecular Biology: Concepts and Experiments p.435 Category I: Huntington’s disease (HD) and the spinocerebellar ataxias, CAG in CDS. Category II: expansions tend to be more phenotypically diverse with heterogeneous expansions that are generally small in magnitude, but also found in the exons of genes. Category III: fragile X syndrome, myotonic dystrophy, juvenile myoclonic epilepsy, and Friedreich’s ataxia, non-CDS.

  10. Fragile X Syndrome wt mutant male II-1 asymptomatic hemizygous carrier daughter III-1 asymptomatic, but expanded repeat in germ line Bassell GJ, Warren ST (2008). "Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function". Neuron60 (2): 201–14. FMRP from FMR1

  11. Huntington’s disease 4p16.3

  12. Inversions, translocations, etc. Inversion through chromosome breakage & rejoining Fig. 1.20 - shown as single stranded, but both DNA strands inverted

  13. Inversions, translocations, etc. Inversion - recombination between indirect repeats What would be outcome of recombination between direct repeats? Fig. 1.20

  14. Deletion A B C D A D … … … … + See Fig. 1.17

  15. “Hot spots” of mutation - short direct repeats, palindromes - alternating Pu-Py dimers (Z-DNA) - CpG in eukaryotes -deamination of C to U, repaired by uracil-DNA glycolyase - but 5-methyl C to T escapes repair patterns & positions of mutations not random Griffiths Fig. 7.16

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer