omer
Uploaded by
61 SLIDES
1206 VUES
650LIKES

Transcription

DESCRIPTION

Transcription. Chapter 8. The Problem. Information must be transcribed from DNA in order function further. REMEMBER: DNA RNAProtein. Tanscription in Prokaryotes. Polymerization catalyzed by RNA polymerase Can initiate synthesis Uses rNTPs Requires a template

1 / 61

Télécharger la présentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Transcription Chapter 8

  2. The Problem • Information must be transcribed from DNA in order function further. • REMEMBER: • DNARNAProtein

  3. Tanscription in Prokaryotes • Polymerization catalyzed by RNA polymerase • Can initiate synthesis • Uses rNTPs • Requires a template • Unwinds and rewinds DNA • 4 stages • Recognition and binding • Initiation • Elongation • Termination and release

  4. RNA Polymerase • 5 subunits, 449 kd (~1/2 size of DNA pol III) • Core enzyme • 2  subunits---hold enzyme together • --- links nucleotides together • ’---binds templates • ---recognition • Holoenzyme= Core + sigma

  5. RNA Polymerase Features • Starts at a promoter sequence, ends at termination signal • Proceeds in 5’ to 3’ direction • Forms a temporary DNA:RNA hybrid • Has complete processivity

  6. RNA Polymerase • X-ray studies reveal a “hand” • Core enzyme closed • Holoenzyme open • Suggested mechanism • NOTE: when sigma unattached, hand is closed • RNA polymerase stays on DNA until termination.

  7. Recognition • Template strand • Coding strand • Promoters • Binding sites for RNA pol on template strand • ~40 bp of specific sequences with a specific order and distance between them. • Core promoter elements for E. coli • -10 box (Pribnow box) • -35 box • Numbers refer to distance from transcription start site

  8. Template and Coding Strands Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand 5’–TCAGCTCGCTGCTAATGGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ transcription 5’–UCAGCUCGCUGCUAAUGGCC–3’ RNA transcript

  9. Consensus sequences Typical Prokaryote Promoter • Pribnow box located at –10 (6-7bp) • -35 sequence ~(6bp) • Consensus sequences: Strongest promoters match consensus • Up mutation: mutation that makes promoter more like consensus • Down Mutation: virtually any mutation that alters a match with the consensus

  10. In Addition to Core Promoter Elements • UP (upstream promoter) elements • Ex. E. coli rRNA genes • Gene activator proteins • Facilitate recognition of weak promoter • E. coli can regulate gene expression in many ways

  11. Stages of Transcription • Template recognition • RNA pol binds to DNA • DNA unwound • Initiation • Elongation • RNA pol moves and synthesizes RNA • Unwound region moves • Termination • RNA pol reaches end • RNA pol and RNA released • DNA duplex reforms

  12. Transcription Initiation • Steps • Formation of closed promoter (binary) complex • Formation of open promoter complex • Ternary complex (RNA, DNA, and enzyme), abortive initiation • Promoter clearance (elongation ternary complex) • First rnt becomes unpaired • Polymerase loses sigma • NusA binds • Ribonucleotides added to 3’ end

  13. Back • Holoenzyme • Core +  • Closed (Promoter) Binary Complex • Open binary complex • Ternary complex • Promoter clearance

  14. Sigma () Factor • Essential for recognition of promoter • Stimulates transcription • Combines with holoenzyme • “open hand” conformation • Positions enzyme over promoter • Does NOT stimulate elongation • Falls off after 4-9 nt incorporated • “Hand” closes

  15. Variation in Sigma • Variation in promoter sequence affects strength of promoter • Sigmas also show variability • Much less conserved than other RNA pol subunits • Several variants within a single cell. EX: • E. coli has 7 sigmas • B. subtilis has 10 sigmas • Different  respond to different promoters

  16. Sigma Variability in E. coli • Sigma70 (-35)TTGACA (-10)TATAAT • Primary sigma factor, or housekeeping sigma factor. • Sigma54 (-35)CTGGCAC (-10)TTGCA • alternative sigma factor involved in transcribing nitrogen-regulated genes (among others). • Sigma32 (-35)TNNCNCNCTTGAA (-10)CCCATNT • heat shock factor involved in activation of genes after heat shock. • POINT: gives E. coli flexibility in responding to different conditions

  17. Sigma and Phage SP01 • Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28. • gp28 recognizes a phage promoter for expression of mid-stage genes, including • gp33/34, which recognizes promoters for late gene expression.

  18. Promoter Clearance and Elongation • Occurs after 4- 10 nt are added • First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal • Polymerase loses sigma, sigma recycled • Result “Closed hand” surrounds DNA • NusA binds to core polymerase • As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal. • RNA pol/NusA complex stays on until termination. Rate=20-50nt/second.

  19. Termination • Occurs at specific sites on template strand called Terminators • Two types of termination • Intrinsic terminators • Rho () dependent treminators • Sequences required for termination are in transcript • Variation in efficiencies.

  20. Intrinsic Terminators • DNA template contains inverted repeats (G-C rich) • Can form hairpins • 6 to 8 A sequence on the DNA template that codes for U • Consequences of poly-U:poly-A stretch? Coding strand

  21. Intrinsic Termination • RNA pol passes over inverted repeats • Hairpins begin to form in the transcript • Poly-U:poly-A stretch melts • RNA pol and transcript fall off UUUUU

  22. Rho () Dependent Terminators • rho factor is ATP dependent helicase • catalyses unwinding of RNA: DNA hybrid

  23. (17 bp) Rho Dependent Termination • rho factor is ATP dependent helicase • catalyzes unwinding of RNA: DNA hybrid • 50~90 nucleotides/sec

  24. Rho: Mechanism hexamer • Rho binds to transcript at  loading site (up stream of terminator) • Hairpin forms, pol stalls • Rho helicase releases transcript and causes termination

  25. Abortive initiation, elongation

  26. mRNA • Function—Transcribe message from DNA to protein synthesis machinery • Codons • Bacterial—polycistronic • Eukaryotic– monocistronic • Leader sequence—non-translated at 5’ end • May contain a regulatory region (attenuator) • Also untranslated regions at 3’ end. • Spacers (untranslated intercistronic sequences) • Prokaryotic mRNA—short lived • Eukaryotic mRNA-can be long lived

  27. Stable RNA • rRNA -Structural component of ribosomes • tRNA-Adaptors, carry aa to ribosome • Synthesis • Promoter and terminator • Post-transcriptional modification (RNA processing) • Evidence • Both have 5’ monophospates • Both much smaller than primary transcript • tRNA has unusual bases. EX pseudouridine

  28. tRNA and rRNA Processing • Both are excised from large primary transcripts • 1º transcript may contain several tRNA molecules, tRNA and rRNA • rRNAs simply excised from larger transcript • tRNAs modified extensively 5. Base modifications

  29. Examples of Covalent Modification of Nucleotides in tRNA 7-Methylguanylate (m7G) Inosinate (I) N6-Methyladenylate (m6A) N6-Isopentenyladenylate (i6A) Uridylate 5-oxyacetic acid (cmo5U) Dihydrouridylate (D) Pseudouridylate (Ψ) (ribose at C-5) 3-Methylcytidylate (m3C) Modifications are shown in blue. 5-Methylcytidylate (m5C) 2’-O-Methylated nucleotide (Nm)

  30. Eukaryotic Transcription • Regulation very complex • Three different pols • Distinguished by -amanitin sensitivity • Pol I—rRNA, least sensitive • Pol II– mRNA, most sensitive • Pol III– tRNA and 5R RNA moderately sensitive • Each polymerase recognizes a distinct promoter

  31. Eukaryotic RNA Polymerases

  32. Eukaryotic Polymerase I Promoters • RNA Polymerase I • Transcribes rRNA • Sequence not well conserved • Two elements • Core element- surrounds the transcription start site (-45 to + 20) • Upstream control element- between -156 and -107 upstream • Spacing affects strength of transcription

  33. Eukaryotic Polymerase II Promoters • Much more complicated • Two parts • Core promoter • Upstream element • Core promoter • TATA box at ~-30 bases • Initiator—on the transcription start site • Downstream element-further downstream • Many natural promoters lack recognizable versions of one or more of these sequences

  34. TATA-less Promoters • Some genes transcribed by RNA pol II lack the TATA box • Two types: • Housekeeping genes ( expressed constitutively). EX Nucleotide synthesis genes • Developmentally regulated genes. EX Homeotic genes that control fruit fly development. • Specialized (luxury) genes that encode cell-type specific proteins usually have a TATA-box

  35. mRNA Processing in Eukaryotes • Primary transcript much larger than finished product • Precursor and partially processed RNA called heterogeneous nuclear RNA (hnRNA) • Processing occurs in nucleus • Splicing • Capping • Polyadenylation

  36. Capping mRNA • 5’ cap is a reversed guanosine residue so there is a 5’-5’ linkage between the cap and the first sugar in the mRNA. • Guanosine cap is methylated. • First and second nucleosides in mRNA may be methylated BACK

  37. Polyadenylation • Polyadenylation occurs on the 3’ end of virtually all eukaryotic mRNAs. • Occurs after capping • Catalyzed by polyadenylate polymerase • Polyadenylation associated with mRNA half-life • Histones not polyadenylated

  38. Introns and Exons • Introns--Untranslated intervening sequences in mRNA • Exons– Translated sequences • Process-RNA splicing • Heterogeneous nuclear RNA (hnRNA)-Transcript before splicing is complete

  39. Splicing Overview • Occurs in the nucleus • hnRNAs complexed with specific proteins, form a ribonucleoprotein particle (RNP) • Primary transcripts assembled into hnRNP • Splicing occurs on spliceosomes consist of • Small nuclear ribonucleoproteins (SnRNPs) • components of spliceosomes • Contain small nuclear RNA (snRNA) • Many types of snRNA with different functions in the splicing process

  40. Spliceosome

  41. Splice Site Recognition • Introns contain invariant 5’-GU and 3’-AG sequences at their borders (GU-AG Rule) • Recognized by small nuclear ribonucleoprotein particles (snRNPs) that catalyze the cutting and splicing reactions. • Internal intron sequences are highly variable even between closely related homologous genes. • Alternative splicing allows different proteins from a single original transcript

  42. Simplified Splicing Mechanism

  43. Close-up of Internal A

  44. Alternative Splicing I • Exon removed with intron

  45. Alternative Splicing II • Multiple 3’ cleavage sites • EX. AG found at 5’ end of exon 2 and inside exon 2

  46. RNA pol III • Precursors to tRNAs,5SrRNA, other small RNAs • Promoter Type I • Lies completely within the transcribed region • 5SrRNA promoter split into 3 parts • tRNA promoters split into two parts • Polymerase II-like promoters • EX. snRNA • Lack internal promoter • Resembles pol II promoter in both sequence and position

  47. DNAse Footprinting • Use: promoter ID • End Label template strand • Add DNA binding protein • Digest with DNAse I • Remove protein • Separate on gel Protected region

  48. siRNA and microRNA

  49. Maxam-Gilbert Sequencing • Prep ssDNA • End label • Treat with different reagents specific for each nt

  50. RNA Splicing RNA splicing is the removal of intervening sequences (IVS) that interrupt the coding region of a gene Excision of the IVS (intron) is accompanied by the precise ligation of the coding regions (exons)

More Related