quinto
Uploaded by
63 SLIDES
872 VUES
640LIKES

Genetic Evidence of Human Evolution: Insights from Carl Sagan's Universe

DESCRIPTION

Explore the fascinating journey of human evolution through genetic evidence, as illustrated by a cosmic timeline derived from Carl Sagan’s universe model. This analysis reveals the similarities and differences between human and chimpanzee chromosomes, underscoring the shared ancestry we possess with these primates. Discover how telomeres and DNA sequences provide insight into chromosomal fusion events in our evolutionary past. By examining these genetic markers, we can better understand our origins and the ancient life woven into our very DNA, making the past part of us today.

1 / 63

Télécharger la présentation

Genetic Evidence of Human Evolution: Insights from Carl Sagan's Universe

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Human Evolution Genetic Evidence

  2. Carl Sagan’s Universe Calendar • 1 year = 13.75 billion years (~Age of Universe) • 24 days = 1 billion years • 1 second = 475 years • “Big Bang” January 1 • Milky Way May 1 • Solar System September 9 • Life on Earth September 25 • Humanlike Primates December 31, 10:30pm Milky Way

  3. 23 Human Chromosomes

  4. 24 Chimp Chromosomes

  5. Are there Similarities? Side by Side - Human/Chimp

  6. Just the first 7 – any identical?

  7. Identical Banding Patterns indicate a Common Ancestor • DNA analysis and fossils tell us thatthis split was around 6-7 million years ago (6-7 mya) Chimps Us <---Common Ancestor

  8. Are there Differences? Side by Side - Human/Chimp - Chimp’s #2 is shorter than our #2 - Chimp has an extra unmatched chromosome

  9. Maybe the chimp’s“extra” chromosomewas once part of itsshort #2. Could the “extra”chromosome match the upper part ofour #2? LET’S TRY IT… 10

  10. Nope!They don’t seemto match.What else couldwe try? Turn the “extra” oneupside down?! Let’s try it… 11

  11. WOW !IT WORKED! They DO MATCH! NOW, the next question:“How could this happen?” • Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR • Were there TWO shortchromosomes in our ancestor that fused (joined) to make ONE in humans? 13

  12. We could look for evidence offusion in the middle of our#2 chromosome… It so happens that ALL chromosomes have special tip ends, called “telomeres”… 14

  13. All Chromosomes have telomeres at bothends(like shoelace aglets!) HeadTelomere Centromere TailTelomere Telomeres have a special DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

  14. Here’s another view ofa chromosome,showing the telomeresuntwisted, and their typicalDNA sequence It also shows that theupper (shorter) armabove the centromereis called the “p-arm”, andthe lower (longer) arm iscalled the “q-arm”

  15. TELOMERE DNA CLOSE-UP Here are ends of the uppertelomeres of thechimp’s “short”chromosome (left)… and its “extra”chromosome (right) 17 Short #2 “Extra”

  16. NOTICE! When we turn the “extra”chromosome upside-down,and try to connect it to the“short” chromosome, it onlyFITS one way (left)… They do NOT fitwhen one telomere istwisted 180o (right)

  17. FURTHERMORE…When we lay the fusion area on its side,we can see more clearly how the DNA sequencechanges at the fusion point. Reading the top strand only, see:T T A G G G C C C T A A

  18. 108061 agcacagacctgggggtcaccgtaaaggtggagcagcattcccctaagcacagaggttgg 108121 ggccactgcctggctttgtgacaactcggggcgcatcaacggtgaataaaatctttcccg 108181 gttgcagccgtgaataatcaaggttagagaccagttagagcggttcagtgcggaaaacgg 108241 gaaagaaaaagcccctctgaatcctgggcagcgagattctcccaaagcaaggcgaggggc 108301 tgcattgcagggtgagggtgagggttagggtttgggttgggtttggggttggggttgggg 108361 taggggtggggttggggttggggttggggttaggggtaggggtaggggtaggggtagggt 108421 cagggtcagggtcagggttagggttttagggttaggattttagggttagggtaagggtta 108481 agggttggggttggggttagggttaggggttagggttggggttggggttggggttggggt 108541 tggggttggggttagggttagctaaacctaaccctaacccctaaccccaaccccaacccc 108601 aaccctacccctacccctacccctaaccccaacccccacccttaacccttaacccttacc 108661 ctaaccctaacccaaaccctaaccctaccctaaccctaacccaaccctaaccctaaccct 108721 accctaaccctaacaccctaaaaccgtgaccctgaccttgaccctgacccttaaccctta 108781 accctaaccataaccctaaaccctaaccctaaaccctaaccctaaaccctaaccctaaca 108841 ctaccctaccctaaccccaacccctaacccctaaccctaaccctacccctaaccccaacc 108901 ccagccccaacccttaccctaaccctaccctaacccttaaccctaacccctaaccctaac 108961 ccctaaccctaaccctaccccaaccccaaacccaaccctaacccaaccctaacccctaac 109021 cctaacccctaccctaacccctagccctagccctagccctaaccctaaccctcgccctaa 109081 ccctcaccctaaccctcaccctcaccctaacccaacgtctgtgctgagaagaatgctgct 109141 ccgcctttaaggtgccccccaggtctgtgctgaacagaacgcagctccgccgtcgcagtg 109201 ccctcagcccgcccgcccgggtctgacctgagaagaactctgctccgccttcgcaatagc 109261 cccgaagtctgtgcagaggagaacgcagctccgccctcgcgatgctctccggctgtgtgc 109321 taaagagaacgcaactccgccctcgcaaaggcggcgcgccggcggaggcgcggagaggcg HeadTelomereof “extra”chrom. 2a HeadTelomereof “short”chrom. 2b FUSION POINT ! 20

  19. Did you know… you’ve got FOSSILS in YOU ! All of you have these fossils,in the #2 chromosome of every cell ! 108361 taggggtggggttggggttggggttggggttaggggtaggggtaggggtaggggtagggt 108421 cagggtcagggtcagggttagggttttagggttaggattttagggttagggtaagggtta 108481 agggttggggttggggttagggttaggggttagggttggggttggggttggggttggggt 108541 tggggttggggttagggttagctaaacctaaccctaacccctaaccccaaccccaacccc 108601 aaccctacccctacccctacccctaaccccaacccccacccttaacccttaacccttacc 108661 ctaaccctaacccaaaccctaaccctaccctaaccctaacccaaccctaaccctaaccct 108721 accctaaccctaacaccctaaaaccgtgaccctgaccttgaccctgacccttaaccctta Fossils are the remains of ancient life,and these are the telomeres oftwo chromosomes from your ancient ancestor ! So, these telomeres are your very ownMOLECULAR FOSSILS ! 21

  20. What about other apes? • For each number,the chromosomesare arranged in this order(left to right):human, chimpanzee,gorilla, orangutan

  21. Did you notice… All the other apes had that“extra” chromosome, too? This confirms that this isthe more PRIMITIVE (original)CONDITION, so our SINGLE #2 chromosome is the DERIVED CONDITION (the result of fusion) 23

  22. Chimps Humans Common Ancestors 24

  23. More Confirming Evidence.. When we compare primates by using other features,including DNA, different proteins, anatomy, physiology, and fossils,Biologists have developed similarCladograms (Phylogenetic Trees),like these…

  24. Based on Albumin Protein Analysis: Based on DNA Hybridization Analysis See how similarthey are? 26

  25. And here’s another one…PRIMATE CLADOGRAMBased on Genome Analysis Species Today Humans Bonobos 6 mya Chimpanzees 8 mya Gorillas Orangutans 13 mya 18 mya Gibbons Old World Monkeys 25-30 mya Common Ancestor Again, basically the same pattern 27

  26. Human Evolution Fossil Evidence

  27. (a) New World monkeys, such as spider monkeys (shown here), squirrel monkeys, and capuchins, have a prehensile tail and nostrils that open to the sides. (b) Old World monkeys lack a prehensile tail, and their nostrils open downward. This group includes macaques (shown here), mandrills, baboons, and rhesus monkeys. New World and Old World Monkeys • Underwent separate adaptive radiations during their many millions of years of separation

  28. 30 million years ago

  29. 20 Million Years Ago

  30. (a) Gibbons, such as this Muller's gibbon, are found only in southeastern Asia. Their very long arms and fingers are adaptations for brachiation. (b) Orangutans are shy, solitary apes that live in the rain forests of Sumatra and Borneo. They spend most of their time in trees; note the foot adapted for grasping and the opposable thumb. (c) Gorillas are the largest apes: some males are almost 2 m tall and weigh about 200 kg. Found only in Africa, these herbivores usually live in groups of up to about 20 individuals. (e) Bonobos are closely related to chimpanzees but are smaller. They survive today only in the African nation of Congo. (d) Chimpanzees live in tropical Africa. They feed and sleep in trees but also spend a great deal of time on the ground. Chimpanzees are intelligent, communicative, and social. Figure 34.40a–e Hominoids – split from old world monkeys ~ 20-25 mya; “apes”

  31. 13 Million Years Ago – Orangutans split

  32. 8 mya – Gorillas split

  33. 6–7 mya – Hominids split

  34. Chimps & Bonobos – split 6 mya

  35. Skeletons

  36. Pelves

  37. Crania Comparison

  38. Dentition Comparison of dentition in ape, human, and A. afarensis palates.

  39. Paranthropusrobustus Homoneanderthalensis Homosapiens 0 Paranthropusboisei Homoergaster ? 0.5 1.0 Australopithecusafricanus 1.5 2.0 Kenyanthropusplatyops 2.5 Australopithecusgarhi Homoerectus 3.0 Millions of years ago Australopithecusanamensis 3.5 Homohabilis Homorudolfensis 4.0 4.5 Ardipithecusramidus Australopithecusafarensis 5.0 5.5 Orrorin tugenensis 6.0 6.5 Sahelanthropustchadensis 7.0 Hominids – Australopithecus & Homo

  40. Ardipithecusramidus • Hominid who walked bipedally 4.4 mya • Discovered in 1992 by Tim White in Aramis, Ethiopia • A new species? • ape-like dentition • bipedal locomotion • overall hominid-like skeleton • small cheek teeth with thin enamel and large canines • arm bones are hominid- like • foramen magnum indicates bipedalism

  41. Genus Australopithecines • A. animensis 4.2 - 3.8 mya • A. afarensis 4 – 3 mya • A. africanus3 – 2.2 mya • A. gahri2.5 mya

  42. Australopithecus afarensis • apelike features (long arms, prognathic face, toothrow, brain capacity) • pelvis, leg, feet, and foramen magnum all indicate bipedalism • 4.2 mya, with oldest definite specimen placed at 3.8 mya • first discovered by Don Johanson in 1974 and called “Lucy” • thought to be the “missing link” until A. anamensis was discovered 20 years later

  43. (a) Lucy, a 3.24-million-year-old skeleton, represents the hominid species Australopithecus afarensis. (b) The Laetoli footprints, more than 3.5 million years old, confirm that upright posture evolved quite early in hominid history. (c) An artist’s reconstruction of what A. afarensis may have looked like.

  44. A. africanus • 3.5 - 2.5 mya • 3.8 - 4.5 feet tall, 55-130 lbs • ape-like tibia, grasping big toes • wide pelvis, parabolic tooth row • primitive bipedalism • first found by Raymond Dart in Taung, South Africa in 1925

  45. Map of Australopithecine Finds Map of Australopithecus sites in Africa, with a focus on the East African rift valley and limestone caves of South Africa.

  46. Genus Homo • Major Homo advances: • Brain size • Better bipedalism • Hunting • Fire (H. erectus) • Tools • Oldowon (H. habilis) • Acheulean (H. erectus) • Mousterian (H. heidelbergensis) • Solutrean (H. sapiens) • Built shelters (H. heidelbergensis) • Clothing (H. neandertalensis) • Language (Neandertals?)

More Related