140 likes | 265 Vues
Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay. Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon. Laboratories of America. Z. Why Impedimetric Detection?. Functionalized sensor – prior to analysis. Target analyte species bind to sensor
E N D
Impedance Sensor Arraysfor Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America
Z Why Impedimetric Detection? Functionalized sensor – prior to analysis Target analyte species bind to sensor – impedance changes in real time Analyte injection • Advantages: • Label-free, real-time and rapid detection; • Inexpensive devices; • Local company (Camas, WA).
Project Aims: #1 SH (thiol) Sensor array with reaction chamber attached New v3.0 sensor array format to test Sensor array surface functionalization • New SLA READER • Measures 15 channels • simultaneously • Eight impedance • measurements • per second per channel. • Sensor temperature • control. DNA oligonucleotide Au Au Ready for nucleic acid assay
Project Aims: #2 Development of genomic assays • Detection of all E. coli strains using probes for a housekeeping gene adenylate kinase (ADK); • Detection of enteropathogenic E. coli isolates using virulence genes, hemolysin A (HlyA), and shiga toxin 2 (Stx2). E. coli strains • common commensal (laboratory K12) MG1655: adk gene only; • uropathogenic clinical isolate CFT073: adk and hlyA genes; • enterohemorrhagic (O157:H7, food poisoning) EDL 933: adk and stx2b genes.
Project Aims: #2 Template E. coli genomic DNA PCR Amplicon Probe binding part Probes: Array functionalization ADK probe: TGGAGAAATATGGTATTCCG HlyA probe: TGAATTCCAGAAGCAAGTCT Stx2b probe: GCGGTTTTATTTGCATTAGT Target preparation: 1 Primer 2 Primer
hlyA targets ds ss 500 400 300 200 75 Target preparation in detail: Target types: Single-stranded (ssDNA) Double-stranded (dsDNA) PCR amplicon PCR amplicon 95oC for 5 min l exonuclease digestion extra purification Simple and fast Standard, more sensitive?
dsDNA test: Assay development Goals: to optimize conditions and to compare to the ssDNA test in terms of sensitivity (detection limit), specificity, and dynamic range. Assay parameters: tested selected Target concentration 2.5 and 0.5 µg/ml 0.5 µg/ml Buffer (SSPE) concentration 1x, 2x, 4x 2x Voltage (excitation potential) 40, 75, 100, 150 mV 75 mV Temperature 47, 52oC 52 oC?? For almost ALL tests Stx negative control demonstrated negligible signal. Hly negative control response minimization was the major challenge for assay optimization.
Parallel Injection of Targets = ADK; specific = HlyA; neg. = Stx2; control Baseline Sample injection
Sequential injection of targets to the same sensor arrays: HlyA buffer Hly ADK
Sequential injection results: Stx2 buffer Stx ADK
Conclusions • dsDNA target preparation • Optimized conditions • Demonstrated specific detection using ADK-functionalized sensor arrays • Still to do: Compare ssDNA and dsDNA targets
Acknowledgements • Mariya Smit • Andrei Ghindilis • Holly Simon • Chris Brow • Simon/Haygood/Tebo Labs • Vanessa Green • CMOP • SLA: Kevin & Carmen • NSF