Understanding Molecular Exercise Physiology: Mechanisms and Implications
This presentation introduces Molecular Exercise Physiology, which examines how exercise influences cellular signaling and gene expression for muscle and organ adaptation. Learn about key concepts such as gene transcription, exercise-activated signal transduction pathways, and their roles in conditions like diabetes and aging. By the end of the session, participants will grasp the importance of molecular mechanisms in exercise science, and how this understanding helps improve athletic performance and health outcomes. Contact Dr. Henning Wackerhage for more information.
Understanding Molecular Exercise Physiology: Mechanisms and Implications
E N D
Presentation Transcript
Molecular Exercise PhysiologyWhat is Molecular Exercise Physiology?Presentation 1Henning Wackerhage
Important The online presentations on Molecular Exercise Physiology may be used for self-teaching purposes for Molecular Exercise Physiology-SIG members. However, the must not be used for teaching students without prior authorisation. If we wish to use some of these slides for your presentations to students, please contact: Dr Henning Wackerhage Senior Lecturer in Molecular Exercise Physiology University of Aberdeen E-mail: h.wackerhage@abdn.ac.uk
Learning outcomes • At the end of this presentation you should be able to: • Define the term Molecular Exercise Physiology and give examples for research questions in Molecular Exercise Physiology. • Explain how a gene is transcribed and translated into a protein. • Explain how exercise-activated signal transduction pathways may regulate transcription and translation of proteins.
Definition Prof. Frank Booth was one of the first researchers in Cellular and Molecular Exercise Physiology. See: Booth FW: Perspectives on molecular and cellular exercise physiology. J. Appl. Physiol, 65: 1461-1471, 1988. Molecular exercise physiology is a shortened version of the term used by Booth. A narrow definition of the term “molecular exercise physiology” is given below: Molecular exercise physiology is the study of signal transduction and genetics in relation to exercise. Molecular exercise physiologists aim to characterise the mechanisms that are responsible for the adaptation of cells and organs to exercise and to identify the genetic determinants of athletic talent.
Applications of molecular exercise physiology • Possible applications are: • Investigate the molecular basis of muscle adaptation to exercise. • Detect the signal transduction and gene regulation changes in states such as diabetes mellitus, muscle unloading or ageing and investigate whether exercise can reverse these changes. • Why study Molecular Exercise Physiology? • Because it can explain adaptations that have been described previously. • Because the research benefits from and advances other fields such as cancer and ageing research. • Major advances in knowledge occur at the moment while most other exercise research is not that novel.
Classical approach ? Exercise Adaptations “Black box”
Molecular exercise physiology approach Molecular Exercise Physiologist Signal transduction & gene regulation Exercise Adaptations “Black box”
Examples Classical exercise physiologists found that endurance exercise increases the number of capillaries in a muscle. Molecular exercise physiologists try to identify the exercise-activated signal transduction pathways that are responsible for the growth of capillaries. Classical exercise physiologists have described the growth of muscle fibres in response to resistance training. Molecular exercise physiologists have identified how exercise may activate regulators of translation/protein synthesis. Classical exercise physiologists have discovered that exercise makes hearts grow (cause the athlete’s heart). Molecular exercise physiologists have identified candidate signal transduction pathways that may regulate the growth of heart muscle cells. There is much more to discover!
Definition A gene is DNA that codes for a protein. Please note: Not all DNA is coding for proteins. There are large non-coding regions and some genes code just for RNA (will be explained later). Task: What is the difference between RNA and DNA? What is mRNA and tRNA? Find out.
DNA: The model Watson and Crick used these and other data to model DNA structure: bases occur in CG and AT pairs, double helix. X-ray of DNA (first by Wilkins, Franklin and colleagues at King's College, London)
DNA double helix Nucleosome filament Chromatin filament Nucleosome DNA DNA is coiled, supercoiled and packed
Human chromosomes (23 pairs) Human beings have 23 pairs of chromosomes which are densely packed DNA. However, most of the time DNA is unravelled.
Genome information Some facts about the human genome: Human genome size: about 3,200 Mb (mega bases). Estimated gene numbers: human: 31,000, yeast: 6000, fly: 13,000, worm: 18,000, plant: 26,000. Only 1.1 to 1.4 % of the human sequence encodes protein. The rest is non-coding. 28 % of the sequence is transcribed into RNA (5 % of this is translated into proteins). Only 94 of 1,278 protein families are specific to vertebrates.
How does DNA code for proteins? DNA is a blueprint for proteins. The coding alphabet consists of four “letters” (i.e. bases plus one more in mRNA). Purine bases: Base pairs: Adenine- Thymine Guanine – Cytosine Uracil (instead of T in RNA) Adenine (A) Guanine (G) Pyrimidine bases: Cytosine (C) Uracil (U, RNA) Thymine (T, DNA)
How does DNA code for proteins? The bases are connected and form long DNA chains. Here is a DNA sequence downloaded from the Ensembl genome browser: AGCTTATTCTGCATAATTAGAAAAGAAAGACACCAAGCCATTTAAACATAATTTATGTACTTTATGGCTTTATACAATTATAGCAAAGATTGTTCTTGTGTCTGTAAGTACATCAACATCAGGCACTTCTCAGAGTATCGGAACAAGAACGTGGAATCTGCACTGTTACTAAACTCGGGTAGCGAAATGCAGGAGGCATGACTACGTCCTGATGGGACTTACATGGCCACCCCTGGCCACACTGCCAGGCTGTGC
Gene expression: how it works Reading a gene and producing a protein is a two-step process: First, a gene (red) is transcribed into messenger RNA (mRNA; orange) and second, mRNA is translated into a peptide/protein. Gene GTCTTTCAAATATTGAATATGACAAAGATGTTTACTGTACCAGATTG DNA Transcription mRNA UAUAACUUAUACUGUUUCUACAAAUGA Translation Peptide/protein Peptide sequence: Met (start) Asn Leu Tyr Cys Phe Tyr Lys (termination)
How transcription works Packed DNA TF Step 1. DNA is unravelled and activated transcription factors (TF) bind to the DNA. Pol II TF Step 2. RNA polymerase II (Pol II) is recruited by the active, DNA-bound transcription factor. TF Pol II Step 3. RNA polymerase transcribes gene (shown in green) into mRNA (shown in red).
How translation works Ribosomes are located in the cytosol which is where mRNA is transported to. The mRNA (shown in red) is translated into a polypeptide (shown as a chain of ovals).
How to transcribe DNA into mRNA and how to translate mRNA into protein? If you know a DNA sequence then you can use the genetic code to first transcribe the gene into mRNA and second to translate mRNA into an amino acid (protein) sequence. Some programmes on the internet help you to achieve that. See task on next page.
Task Task: Copy the DNA sequence below and convert it first into mRNA sequence and then a peptide. Use the following website: www.nitrogenorder.org/cgi-bin/nucleo.cgi. TGTCTTTCAAAAAAATGTGAAAACACTTTAATATAACTTATACTGTTTCTACAAATTAGA TGTAAGAAATAATTTCATTTAGTCATAGTACAATAAATTTGATTAACAAAATCCCAATTT ACAAAACAGAAGTAAATAAATGCAGAAATATATTCATTATCAAATTATAAAATAAAAGTA ACAGTTATTGTTGAGATAGCATCAGTTTATTCTTCATTTCAGATAATAGAGTCAATTATT TTGGTATACTTAGTAATGTTTTTGCAAGTATTAAAATAATGGAACGTTGAGATTTAAACA CAATGACAGTAAACCATTGAAATTTCAAATTCACTTTATACAGCCATCATGAATCCATAA GTGAATGTTAATCATGTAAAAAAATATAAAATGATTGTAATATAACCATCTAATCATTAA CATATGGAGTTTTAAGACCACTATTTAATCTGCTAATTTGCTCTGAAATATAAGTAGTTG CTTTTCTGTGATGCATGACATGTCTTTGTGCCTTAGTACTTAATTTGAAATGTCCTTAGT GTAAAAATATACCAAAGTAAATAAAAAAGGAGACACTTATTTACAAAACAATATTGTATA CATATTATATAAATGCATTGTTTCAGTCTTTTTATACAATATTGATAGAGTCGATCATTT
Important You should have learned about transcription and translation before and the presentation should have been a revision. You will do well in this module if you know transcription and translation inside out. There are numerous websites and textbooks in which transcription and translation are described. Do not proceed until you can explain the following terms and reactions well: DNA, intron, exon Transcription factor, transcription factor binding site, RNA polymerase II, mRNA Translation, peptide, protein
IntroductionPart 3Exercise changes transcription and translation
Exercise regulates transcription and translation Exercise stimulates acute and chronic adaptations probably in every organ of the body. Many of these adaptations are mediated by so-called signal transduction pathways that regulate the transcription and translation of genes. The sequence of events is: Exercise signals activation/inhibition of signal transduction pathway change in gene transcription, translation or other cell function (= adaptation). Today, Molecular Exercise Physiology researchers aim to trace this sequence of events for many adaptations to exercise. Here, I will briefly introduce how trancription and translation may be regulated by exercise.
How exercise may regulate transcription Exercise signal (1) P Transcription (2) mRNA P P Nucleus (1) In this model, an exercise signal (such as calcium, stretch, energy stress) leads to the activation of a signalling protein (green) by phosphorylation. (2) The signalling protein then phosphorylates a transcription factor (blue) which promotes the translocation of the transcription factor into the nucleus. (3) The transcription factor binds to the DNA which increases the transcription of a gene (i.e. increase in mRNA).
Exercise regulates transcription Example: Zambon et al. (2003) used so-called DNA microarrays (gene chips) in order to identify genes whose expression (i.e. whose mRNA content) was changed in muscle 6 h after resistance training. DNA microarrays allowed the researchers to measure the gene expression of 20,000 genes in one two-day experiment. The table below contains some results (the real results table consists of 20,000 rows!). Column 1 in the table below gives a gene description, column 2 the fold change (exercised versus non-exercised leg) and the p-value indicates the significance of the change. The data indicate that the mRNA of the first three genes was significantly decreased (negative change ) and of that the mRNA of the fourth gene was significantly increased 6 h after resistance exercise.
Exercise regulates translation Exercise signal (1) P P (2) mRNA Protein Translation Nucleus (1) In this model, an exercise signal (such as calcium, stretch, energy stress) leads to the activation of a signalling protein (green) by phosphorylation. (2) The signalling protein then phosphorylates a protein (orange) which increases the translation of mRNA into protein (which is protein synthesis). Muscle protein synthesis and translation signalling can be increased for 48 h after resistance exercise.
Exercise regulates translation Translation is the process in which mRNA is used as a blueprint to assemble proteins from amino acids. Thus, translation is protein synthesis. In the recent five years researchers have shown that strength training can increase the general rate of translation. In addition, many of the regulatory proteins that regulate translation have been identified. Example: The figure is taken from Baar and Esser (1999) and shows a Western blot of the p70 S6k protein which is involved in the regulation of translation/protein synthesis. The p70 S6k bands are shifted upwards in response to insulin and 3 h and 6 h after resistance exercise. The changed banding indicates that the protein is activated in these situations.
Task a) How do the following methods work and how may the be used for Molecular Exercise Physiology research questions? - RT-PCR - Western blots - DNA microarray - SNP chips b) Find two research papers each in which the authors investigate the effect of exercise on gene expression (i.e. transcription of a gene) and translation. Use PubMed for your search. Revise this presentation several times and do a lot of additional reading. This material is crucial for the rest of the module.