Analysis of Vrn-B1a and Vrn-B1c Gene Sequences and Secondary Structures in Strand Synthesis
This study explores the DNA sequences of the Vrn-B1a and Vrn-B1c genes, highlighting their structural features and potential mispairing during replication. Two distinct sequences are analyzed for structural integrity and functionality, including possible slip mispairing events. The implications of these findings on replication fidelity and genetic stability are discussed, with a focus on how secondary structures might influence strand synthesis. Understanding these genetic elements is crucial for advancements in plant breeding and genetics.
Analysis of Vrn-B1a and Vrn-B1c Gene Sequences and Secondary Structures in Strand Synthesis
E N D
Presentation Transcript
Vrn-B1a 107 927 1330 1761 // GACCCCAGGGCCTtctccatttccgcgcc // tatagacccaaagtGGTCGGACCCTTCCCCGACCCTGCGC // ATTAGGTGTTCTATGAA // CCCTTGGGATCACCTT // A' B'A F B Secondary structure A' B' A F B A' B' A F B A' Slip mispairing during strand synthesis A' Continue replication 2nd slip mispairing A' B' A F B A' F B' A F B Continue replication Vrn-B1c // GACCCCAGGGCCTATGAA // CCCTTGGGTCGGACCCTTCCCCGACCCTGCGC // ATTAGGTGTTCTATGAA // CCCTTGGGATCACCTT // A' F B'A F B