1 / 1

Analysis of Vrn-B1a and Vrn-B1c Gene Sequences and Secondary Structures in Strand Synthesis

This study explores the DNA sequences of the Vrn-B1a and Vrn-B1c genes, highlighting their structural features and potential mispairing during replication. Two distinct sequences are analyzed for structural integrity and functionality, including possible slip mispairing events. The implications of these findings on replication fidelity and genetic stability are discussed, with a focus on how secondary structures might influence strand synthesis. Understanding these genetic elements is crucial for advancements in plant breeding and genetics.

taline
Télécharger la présentation

Analysis of Vrn-B1a and Vrn-B1c Gene Sequences and Secondary Structures in Strand Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Vrn-B1a 107 927 1330 1761 // GACCCCAGGGCCTtctccatttccgcgcc // tatagacccaaagtGGTCGGACCCTTCCCCGACCCTGCGC // ATTAGGTGTTCTATGAA // CCCTTGGGATCACCTT // A' B'A F B Secondary structure A' B' A F B A' B' A F B A' Slip mispairing during strand synthesis A' Continue replication 2nd slip mispairing A' B' A F B A' F B' A F B Continue replication Vrn-B1c // GACCCCAGGGCCTATGAA // CCCTTGGGTCGGACCCTTCCCCGACCCTGCGC // ATTAGGTGTTCTATGAA // CCCTTGGGATCACCTT // A' F B'A F B

More Related