tarika
Uploaded by
27 SLIDES
429 VUES
270LIKES

Chapter 13

DESCRIPTION

Chapter 13. From DNA to Protein. From Genes to Proteins. Your traits are determined by proteins that are built according to instructions in DNA. These sections of DNA are your genes. The first step in decoding the DNA instructions is to copy part of the DNA into RNA. 13.1 RNA.

1 / 27

Télécharger la présentation

Chapter 13

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 13 From DNA to Protein

  2. From Genes to Proteins • Your traits are determined by proteins that are built according to instructions in DNA. • These sections of DNA are your genes. • The first step in decoding the DNA instructions is to copy part of the DNA into RNA.

  3. 13.1 RNA • Like DNA, RNA consists of a long chain of nucleotides. • 3 main differences between DNA and RNA: • The sugar in RNA is ribose, not deoxyribose. • RNA is single – stranded, while DNA is double – stranded • RNA contains uracil instead of thymine.

  4. 3 Types of RNA: • Messenger RNA (mRNA) – serves as “messengers” from DNA to the rest of the cell. • Ribosomal RNA (rRNA) – make up ribosomes

  5. 3. Transfer RNA (tRNA) – transfers each amino acid to the ribosome. Met Amino Acid tRNA Anticodon A U G

  6. RNA Synthesis: Transcription • Occurs in the nucleus • Copying part of DNA into a complementary sequence in RNA. • Requires an enzyme known as RNA polymerase. • RNA polymerase binds to DNA and separates the DNA strands. • It uses one strand of DNA as a template to make a strand of mRNA.

  7. How does RNA polymerase know where to start? • Promoters – have specific base sequences where RNA polymerase will bind to begin transcription.

  8. Practice • DNA Template strand: TACGGATCCTAAC • Write the corresponding mRNA sequence:

  9. In eukaryotes, many genes are interrupted by introns, which have no coding information. • Exons are the portions of a gene that are translated. • After transcription the introns in the mRNA are cut out by spliceosomes.

  10. 13.2 Ribosomes and Protein Synthesis Translation • The sequence of bases in mRNA serve as instructions for the order of amino acids to produce proteins (polypeptides).

  11. Steps of Translation: • mRNA transcribed from DNA moves to the cytoplasm. • mRNA attaches to a ribosome.

  12. As mRNA moves across the ribosome the proper amino acid is attached to the growing amino acid chain. • This is the job of tRNA

  13. A peptide bond forms between the amino acids. • until the ribosome reaches a stop codon • releases the amino acid chain.

  14. The Genetic Code • RNA contains 4 bases: adenine, uracil, cytosine, guanine • These 4 letters code for 20 amino acids. • The code is read 3 letters at a time. • Each group of 3 letters is known as a codon.

  15. Separate the following mRNA sequence into codons: • UCGCACGGU

  16. The codon AUG can serve as a “start” codon for protein synthesis (Methionine). There are also 3 “stop” codons which act like a period at the end of a sentence.

  17. Table can be found on p. 367.

  18. Practice Problems • Transcribe and translate the following DNA sequences: • TACGGATATAAGCCGTTAATT mRNA: Protein (polypeptide):

  19. TACAAATGGTTCCTTACAACT mRNA: Protein (polypeptide):

  20. Mutations • Mutations in gametes can be passed on to offspring, but mutations in body cells affect only the individual in which they occur.

  21. Gene Mutations • Point mutation – a single nucleotide change • Insertion • ATCGGA → ATCCGGA • Frameshift Mutations • Deletion • ATCGGA → ATGGA • Substitution • ATCGGA → ACCGGA

  22. Transcribe and translate the following DNA sequence: • TACTATACCTGGACT mRNA: Protein (polypeptide):

  23. Now transcribe and translate that same gene with an insertion mutation: • TACTATACCTGGACCT mRNA: Protein (polypeptide): • How does this protein differ from the original?

More Related