teague
Uploaded by
51 SLIDES
661 VUES
510LIKES

Dive into DNA: The Green Genes Project Workshop

DESCRIPTION

Join the Green Genes: DNA Project Workshop designed for youth development professionals and volunteers. Explore the fascinating world of DNA and the human genome through fun, hands-on activities suitable for afterschool programs and classrooms. This workshop provides insights into the power of genes and how they shape who we are. Discover the goals of the Human Genome Project, learn about genetic traits, and understand the medical and ethical implications of genetic research. Resources will be available on CD and online for future use.

1 / 51

Télécharger la présentation

Dive into DNA: The Green Genes Project Workshop

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Green Genes: DNA ProjectWorkshop Presentation • Group Leaders & Teachers may also opt to use this presentation with • with their group and it will be made available on CD and for downloading • off the Web. • Adapted with permission from Dr. Molly Fitzgerald Hayes & • Dr. Frieda Reichsman from their “MyDNA K12 Teachers Workshop” • in 2002.

  2. Frieda Most Cells Molly From“MyDNA K12 Teacher Workshop”to “Green Genes: a DNA project” UMass MyDNA Class People in the Five College Learning in Retirement Program… …Isolate Their Own DNA!

  3. Green Genes: a DNA ProjectHave fun With DNA! Learn About Your DNA, Genes and the Human Genome Read and understand DNA language Discover YOUR “Book of Life”- the genome Master Plan Understand the power and potential of DNA, genes and genomes • In the Green Genes: DNA project Workshop Youth Development Professional & Volunteers Will: • Find out about awesome and revealing information discovered about the human genome. • Participate in exciting, safe and affordable, • hands-on learning activities appropriate for • Afterschool and the classroom. • Learn about user-friendly on-line DNA molecules

  4. . What is the Human Genome?What is the Human Genome Project? • The HUMAN GENOME: • DNA encoding all human genetic information • “Master Plan” for the human organism • The Body’s Master Plan • The HUMAN GENOME PROJECT: • An international effort to create a complete record of the human “Master Plan”: • 1) Sequence the order of the letters (list of instructions) • 2) Map the “landmarks” (physical locations, blueprint) National Human Genome Research Institute www.nhgri.nih.gov SV40 VIRUS

  5. What are the Goals of the Human Genome Project? • Determine every single letter (base) in our genome DNA (in order). • Read the DNA letters to form the words in our genome instructions (genes). • Locate the instructions (genes, 5%) in the books (chromosomes). • Store the information in databases. • Develop tools for data analysis. • Address the ethical, legal, and social issues arising from the HGP (3%-5% of the budget).

  6. The Genome Instructions • The Human Genome: instruction book for making a human • YOUR genome is like a vast set of books comprising a specific • Master Planfor creating YOU. For example, • Blue eyes • Brown hair • The HUMAN Genome is the generalized Master Plan. For example, • Eyes (not the specific color or shape) • Hair (not the specific color or texture) • The Genome/Master Plan is written in a molecularlanguage, using DNA instead of paper and ink. • The foremost goal of the Human Genome Project was to “read” and record every letter (base) of the Human Master Plan.

  7. Medical Benefits from Genome Research • Better disease diagnosis • Early detection of genetic diseases • Gene therapy treatments • Detection and cures for cancer • Targeted drug designs • Control systems for drug delivery • Personalized treatments and cures • Customized drugs

  8. Other Applications of the Human Genome Project • DNA Science Has a Huge Impact on Many Diverse Fields • Anthropology: Where Did Modern Human Ancestors Come From? • Archeology: Cloning mummy DNA! • Bio-History: Using DNA to Understand the Past! • The Tell-Tale Heart: DNA Identifies Son of • King Louis XVI and Queen Marie Antoinette • Bio-Terrorism and Anthrax • Law, Justice, and The Innocence Project • DNA Privacy and Genetic Discrimination • Lawsuit: Can They Make You Share Genetic Secrets? • Pharmacogenetics: Medicine Prescribed by Your DNA! • Genetically Modified Crops • Genome Music • Gene Therapy • Biomedical Ethics

  9. Our DNA Story Variations on the Human Theme! People look very different from each other, yet, we all have features in common.

  10. Traits are Variations on the Human Theme • Human traits arehuman characteristics that can vary. • Simple traits: • Eyes: Blue, brown, green, etc. • Earlobes: attached, free • Complex traits: • Susceptibility to a disease • Your traits are inherited from your biological parents via genes!

  11. Genes are Physical Elements Responsible for Inherited Traits • Genesare made of DNA: • Genes determine your traits and influence your development • Genes are the means of passing on your traits to your biological children • As a child develops from a fertilized egg: • Genes direct development • When genes act, they are said to be “expressed” • Traits are the result of gene expression.

  12. What Genes Can and Can’t Do! • Genes Can…. • control traits (hair color, eye color, skin color, etc.) • cause disease (sickle cell, hemophilia, cancer, etc.) • influence personality, talents, weaknesses, hobbies, likes, dislikes • increase risk for heart disease, stroke, alcoholism, Alzheimer’s, etc. • Genes Can’t… • make your decisions for you • force you to be a criminal or do things against your will • excuse poor life choices or lack of personal responsibility • Genes ALWAYS… • work together with your environment • Example: genes for growth are influenced by nutrition

  13. The Human Genome is Your Body’s Master Plan! Your Genome Master Plan has: • A list of parts needed to make a unique person, YOU! • Genes with specific instructions for each part needed • Genes written in a coded DNA language • 46 “books” called chromosomes! DNA Chromosomes: 46 Books of Life!

  14. The Human Genome: A Molecular Instruction Book Master Plan Books/Volumes Instructions Words Letters Genome Chromosomes Genes Codons Bases (DNA) 1 23 30,000 1 billion 3 billion

  15. English Language Books • Written on paper • 26 characters • Words of varying length • Punctuation marks • DNA Language “Books” • Written on DNA • 4 characters • Three letter words • Special words Introduction to DNA “Language” • The four characters of DNA are A,C,G, and T. • They stand for four chemical constituents of DNA: • Adenine, Cytosine, Guanine, Thymine. An example of one “strand” of DNA (one DNA molecule): AGCCGTTTTATACGCGTAGTCAGTCGTAGCTCGAGCAAATTA Adapted from “Genome” by Matt Ridley, Perennial Books, NY

  16. DNA Double Helix DNA “Language” is Written Between the DNA Strands DNA letters are strung together in chains, and are attached along the DNA backbone. Two DNA strands wrap around each other in a spiral shape called a double helix. Each chromosome contains one pair of extremely long DNA strands, twisted in a double helix. Two strands = Double helix

  17. G - C C - G DNA Base-Pairing Carries a Message G - C • The MOST INGENIOUS feature of DNA: • A likes to pair with T • C likes to pair with G • The DNA strands in a helix are complementary. • The DNA language contained in a gene is • alwaysreadonly from one DNA strand at a time. DNA Strand #1 A - T A - T DNA Strand #2

  18. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning Follow the Arrow GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  19. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  20. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  21. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  22. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  23. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  24. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  25. DNA STRAND #1 DNA STRAND #2 Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning Etc… GTGGTCTTCAGGAC CACCAGAAGTCCTG DNA STRAND #1 #1 #2 DNA STRAND #2

  26. Genes Store and Send Your DNA Master Plan Your Genes are Written in Four DNA Letters A, T, G, C The nucleus READS the genes and sends INSTRUCTIONS that tell the CELL what to do. Cell makes protein parts that assemble into the molecular machines that do the work in the cell! Nucleus

  27. DNA: GTC TTC AGG CCA AAT TTT GTC GCG CCA GGA ATT Protein: Protein Chains Fold to Make Functional 3D Proteins Amino acid chain folds to make a 3D protein • Proteins are Very Versatile: • Enzymes: • machines that do the work of • the cell • Structural Proteins: • determine shape and layout of the cell Human proteins have 20 different amino acid building blocks A mis-folded protein will not do its job!

  28. Different Protein Chains Fold to Make Proteinswith Different 3D Shapes and Biological Functions Protein #1 Protein #2 Protein #3 Protein #2 Protein #1 Human proteins have 20 different amino acid building blocks Protein #3

  29. How Big is the Human Genome? • Each human genome has 3.2 billion DNA letters • = 3,200,000,000 = 3.2 x 109 • How BIG is 3.2 billion? • 200 New York City telephone books • 800 Bibles • 3 Gigabyte computer hard drive • a person typing 60 words/minute for 8 hours/day would take more than 50 years to type all the letters in the human genome DNA • end-to-end the DNA in one human cell will extend almost 6 feet long

  30. There is More to Our Genome Than Just Genetic Information!What Does It Say? Master Plan Books/Volumes Instructions Words Letters Genome Chromosomes Genes Codons Bases (DNA) 1 23 30,000 1 billion 3 billion Surprise!98% of Human Genome DNA is Gibberish!! Gibberish DNA sequences are not genes. They can be read, but are not yet understood by us!

  31. Compare Any Two Human Genomes: They are 99.9% Identical! • Look around the room and see how different we all look. Then compare two human genomes: • The DNA letters are almost the identicalorder (sequence) between any two human genomes! • A very small number(0.1%) of the DNA letters differ between any two human genomes. • What about identical twins? Genome Facts:NOVA Online

  32. Activity #1: Alphabet Traits

  33. Alphabet Traits: DNA Fingerprinting 1. Enter your traits in the grid above, selecting them from the list below. (See Example on next page) Sex - male or female Eye color – blue, brown, hazel, or green Ear Lobes – free or attached Hairline – widows peak or no widows peak Little finger – bent or straight Chin – dimples or no dimples Tongue – roller or nonroller Skin – freckles or no freckles Spelling counts !!! Please proofread ! PLEASE DO NOT SKIP SPACES BETWEEN WORDS

  34. F N You should have one continuous set of traits, something like this: Alphabet traits Page two 2. Cut out your traits along the heavy black lines and then tape them together end to end. You should have one long strip with all your trait words in a row, no spaces between any letters. Cut off and discard any empty boxes at the end. 3. Now, cut your traits between the following letters.Cut only when the letters occur in the order shown, not the reverse order: E - M E - E B - R E - N T - T S - P G - H O - D O - F F - R N - R E - W 4. Arrange your cut traits by length on the Size Sorting Template. Compare with your classmates! Adapted from: Iowa Academy of Science, http://ists.pls.uni.edu/biomes-geomes/biomes/PDF/sentencesplittingDNA.pdf

  35. YOUR DNA: Your Ultimate Genetic Bar Code • Activity #1: Alphabet Traits: • the students individual physical traits are used to • make specific strings of English language letters that • are cut into patterns of shorter strips • these patterns can specifically identify individual people • DNA Fingerprinting is a method where: • a person’s genetic traits, genes, are used to • make specific strings of DNA letters that • are cut into patterns of shorter strings separated by length • these banding patterns can identify a unique human being! YOUR DNABanding Pattern Will Identify YOU! www.biology.washington.edu/fingerprint/dnaintro.html

  36. Image of a DNA fingerprint

  37. Compare Any Two Human Genomes: They are 99.9% Identical! • Look around the room and see how different we all look. Then compare two human genomes: • The DNA letters are almost the identicalorder (sequence) between any two human genomes! • A very small number(0.1%) of the DNA letters • differbetween any two human genomes. • Small DNA differences can identify individuals as unique. • Except for identical twins! Genome Facts:NOVA Online

  38. Maybe You Shouldn’t Believe Your Eyes! DNA Fingerprinting Reveals The Truth! DNA Fingerprinting has exonerated people who were falsely convicted. What is the most common error leading to wrongful conviction? Mistaken Eyewitness Identification!

  39. Awesome Power: The Innocence Project: DNA MIGHT SET YOU FREE! • Started by O.J. Dream Team Lawyers • Use power of DNA Fingerprinting to “confirm” selected trial verdicts. • Have freed over 100 prisoners who were wrongfully convicted. • Even some Death Row inmates exonerated! • http://www.innocenceproject.org/

  40. Activity #2: Swish and Spit to Isolate Your Own DNA!

  41. SWISH AND SPIT EXPERIMENT BEFORE YOU STARTWe WILL DEMO NOVA Cracking the Code of Life Home Web Site: http://www.pbs.org/wgbh/nova/genome/ NOVA Swish and Spit Activity Site: http://www.pbs.org/wgbh/nova/teachers/activities/2809_genome.html

  42. Make Your Own Genome DNA The Swish and Spit Human DNA Isolation Experiment • HERE WE GO! • People will work in PAIRS today. • Each pair will process ONLY ONE DNA sample at a time. • Everyone will isolate her own DNA by the end of class. • CHECK: • Make sure you have these supplies BEFORE YOU START THE EXPERIMENT! • Each PERSON Should Have: • 1 plastic cup with 10 ml salt solution (0.9%) [Marked: SALT] • 1 large tube with 5 ml detergent (25%) [Marked: SOAP] • CHECK that you can READ the markings on the tubes or cups.

  43. Swish and Spit Human DNA Isolation Steps 1 and 2:Harvest Your Cells, Please! • Experimental Procedure: STEP 1 and STEP 2 • Be sure to follow the instructions carefully. • If you make a mistake, No problem. • ASK for help right away! • WAIT! WE WANT EVERYONE TO START AT THE SAME TIME! • 1. Pour the ENTIRE contents of the PLASTIC CUP marked SALT into • your mouth. • SWILL the salt solution around inside your mouth for about • 30 SECONDS. • 2. SPIT the SALT solution back into the PLASTIC CUP marked SALT.

  44. Swish and Spit Human DNA Isolation Steps 3 and 4:Put the Cells into the SOAP: Why? • Experimental Procedure: STEP 3 and STEP 4 • Carefully POUR the contents of the plastic cup (SALT) • into the LARGE screw cap test tube marked SOAP. • 4. CAP the tube with the screw cap so that it is securely closed. • GENTLY TILT the SOAP tube side-to-side for 3 MINUTES. • IMPORTANT: • DO NOT SHAKE THE SOAP TUBE! NO BUBBLES, PLEASE!

  45. Swish and Spit Human DNA Isolation Steps 5 and 6 • Experimental Procedure: STEP 5 and STEP 6 • OPEN the SOAP tube and hold it at a • slightly TILTED angle. • CAREFULLY POUR the COLD ethanol (ETOH) • from ONE small screw cap tube down the • INSIDE WALL of the SOAP tube. • The COLD ethanol (ETOH) SHOULD FORM A • LAYER on TOP of the SOAP • 6. Set the ETOH/SOAP tube into a rack on the desk for 1 (ONE) MINUTE ETHANOL (ETOH) SOAP

  46. Swish and Spit Human DNA Isolation Step 7:Spool The Stuff Of Life… Experimental Procedure: STEP 7 7.CAREFULLY place the wooden stick into the top, ETOH layer but NOT INTO THE SOAP LAYER. SLOWLY stir in ONE DIRECTION. DO NOT MIX the SOAP layer with the TOP layer!!!! YOU ARE TRYING TO WIND LONG DNA STRANDS AROUND THE STICK (ALTHOUGH YOU PROBABLY CAN’T SEE THE DNA YET) ETHANOL (ETOH) INTERFACE SOAP

  47. Swish and Spit Human DNA Isolation Step 8:See the DNA? • Experimental Procedure: STEP 8 • 8. Slowly stir the glass rod in the TOP layer for several minutes. • Remove the glass rod from the ETOH/SOAP tube and place • it into the SECOND small screw cap tube of ethanol (ETOH). • You should begin to see the DNA strands winding onto the stick by now. • GENTLY dislodge the clumps of DNA from the stick and • CAREFULLY transfer to the SECOND (ETOH) tube. • CAN YOU SEE YOUR DNA????

  48. Activity #3: Build a DNA Model from Paper Parts!

  49. Make Your Own DNA Model! • Please work in pairs. • 1. Make the building blocks of DNA - NUCLEOTIDES • A. Cut out the patterns for 10 bases, 20 sugars, and 20 phosphates. • B. Tape a chemical base to a sugar molecule by matching up the dots. • C. Tape a phosphate group the sugar by matching up the stars. • 2. Make 10 nucleotides. • 3. Lay out a double-stranded DNA molecule using your 10 nucleotides-- • DO NOT TAPE YET!!! • 4. Have your model checked before proceeding to step 5. • 5. Tape your model together. • 6. Tape your model to another model. • 7. Twist carefully, hang it up where everyone can admire it! http://www.mcps.k12.md.us/departments/isa/ninvest/dogma/ballesson.htm

  50. Workshop Resources MyDNA Public Web Site: http://www.bio.umass.edu/biochem/mydna/ Frieda Reichsman’s Web Site: MoleculesInMotion.com Cold Spring Harbor DNA Learning Center: http://www.dnalc.org/ National Human Genome Research Institute: Genome Hub http://www.genome.gov/page.cfm?pageID=10001674 NCBI PubMed (Free access to 12 million MEDLINE citations at National Library of Medicine):http://www.ncbi.nlm.nih.gov/entrez/query.fcgi MyDNA Course (Spring 2002) Website:http://bcrc.bio.umass.edu/courses/spring2002/biochm/biochm193a/syllabus.phtml Ethical, legal and social implications (ELSI) of HGP. Created by Phil Tompkins (Five College Learning in Retirement Program, Amherst, MA).http://www.pdindex.org/lir.htm NOVA: Cracking the Code of Life: http://www.pbs.org/wgbh/nova/genome/

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer