truly
Uploaded by
17 SLIDES
318 VUES
170LIKES

RECOMB-BE

DESCRIPTION

Designing and Building a Bacterial Computer. RECOMB-BE. laheyer@davidson.edu. Dr. Laurie J. Heyer. July 20, 2011. Synthetic Biology.

1 / 17

Télécharger la présentation

RECOMB-BE

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Designing and Buildinga Bacterial Computer RECOMB-BE laheyer@davidson.edu Dr. Laurie J. Heyer July 20, 2011

  2. Synthetic Biology Application of engineering principles and mathematical modeling to the design and construction of biological parts, devices, and systems with applications in energy, medicine, environment, and technology.

  3. Hamiltonian Path Problem Is there a path that: • Starts at node 1 • Ends at node 7 • Visits each node exactly once 3 2 4 1 YES 5 7 NO 6

  4. Hamiltonian Path Problem Is there a path that: • Starts at node 1 • Ends at node 7 • Visits each node exactly once 3 2 4 1 YES 5 ✔ 7 NO 6

  5. A Biological Computer Node = gene Edge = 2 half-genes 1 2 3 4 5 6 7 GFP BLa CAT Cre cFP T7 TT 4  1

  6. A Biological Computer Use hin/hix to rearrange edges: Hinrecombinase from Salmonella typhimurium

  7. A Biological Computer Use hin/hix to rearrange edges: Hinrecombinase from Salmonella typhimurium

  8. HinRecombinase

  9. Identify Solutions 1 4 5 2 3 6 Terminate GFP Cre cFP CAT T7 TT BLa # True Positives = (e - v + 1)! * 2(e - v + 1) # False Positives = ?

  10. Splitting a Gene Reporter ✔ Detectable Phenotype RBS Promoter ✔ Detectable Phenotype? Repo- rter RBS hixC Promoter ✖ Detectable Phenotype? Repo- RBS rter hixC Promoter

  11. Minimize Structural Disruption GFP displaying hixC insertion point

  12. Gene-Splitting Strategy GFP-1 GFP-2 http://gcat.davidson.edu/iGEM07/genesplitter.html

  13. Gene Splitting Tool

  14. Gene Splitter Output Note: Oligos are optimized for melting temperatures.

  15. Embed hixC With Silent Mutations hixC = ttatcaaaaaccatggtttttgataa L S K T M V F D X Y Q K P W F L I X I K N H G F * * ^ ^ ^ ^ ^ ^ ^ ^ Find genes with the “best” match to one of: L S K… … V F D a a tY Q K… … F L I a L S K … V F D a a t Y Q K … F L I a

  16. Conclusion • Synthetic biology is an emerging bioinformatics playground • Biology is more efficient with automation • Existing tools are insufficient • Learn programming (Perl, Python, etc.) • Learn algorithms and data structures • Think and work across disciplinary boundaries

  17. Acknowledgements Malcolm Campbell (Biology, Davidson College) Todd Eckdahl, Jeff Poet (Missouri Western State Univ.) iGEM’06 team: Lance Harden, Karmella Haynes, SabriyaRosemond, Samantha Simpson, Erin Zwack iGEM’07 team: OyinadeAdefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters Karen Acker ’07 Phillip Compeau’08 Funding from HHMI, Davidson College, Missouri Western State University, NSF UBM DMS-0733952 and -0733955

More Related