SlideServe
Télécharger Obtenir Pro
Menu
Accueil Pro
Préférences
ApparenceLight Aide et commentaires
© SlideServe · v2026

Modeling hominid relationships

val avatar
val
15 diapositives · 285 Views · Jul 19, 2014

This activity explores the evolutionary relationships among humans, chimpanzees, and gorillas, analyzing whether humans evolved from modern apes or share a common ancestor. Participants will compare DNA sequences from each species and create hypotheses to illustrate their interconnections. By synthesizing DNA strands and evaluating similarities and differences, learners engage in hands-on research that reinforces concepts of evolution and common ancestry. This inquiry helps clarify misconceptions while utilizing modern research techniques to deepen understanding of genetic relationships in the ape family.

#modeling hominid relationships #modeling hominid relationships ppt #powerpoint #presentation
Modeling hominid relationships - slide 1
01 / 15Modeling hominid relationships
1 / 17

Télécharger la présentation

Modeling hominid relationships
Une image / un lien ci-dessous est fourni (tel quel) pour télécharger la présentation

Politique de téléchargement : le contenu du site vous est fourni TEL QUEL pour votre information et votre usage personnel ; il ne peut être vendu, concédé sous licence ni partagé sur d’autres sites sans l’accord de son auteur.Le contenu vous est fourni TEL QUEL, pour votre information et votre usage personnel uniquement. Téléchargez la présentation en cliquant sur ce lien. Lors du téléchargement, si vous ne parvenez pas à télécharger une présentation, l’éditeur a peut-être supprimé le fichier de son serveur.Pendant le téléchargement, si vous ne parvenez pas à obtenir une présentation, le fichier a peut-être été supprimé par l’éditeur.

F I N

Plus de contenu associé

Transcription de la présentation

  1. Modeling hominid relationships

  2. Engage • Did humans evolve from modern apes, or do modern apes and humans have a common ancestor? • Explain your understanding of the difference between these two questions to your partner.

  3. Explore • The ape family is composed of gibbons, orangutans, chimpanzees, and gorillas. Chimpanzees and gorillas represent the African side of the family; gibbons and orangutans represent the Asian side of the family. The apes we will work with in this activity are the chimpanzee and the gorilla.

  4. Characteristics of Apes and Humans

  5. Evolutionary relationships among organisms from comparisons of skeletons and other characteristics Morphological tree

  6. Explore • How can you use this data to determine relationships among humans, apes, and other animals. • Are structures similar because they carry out the same functions or because they were inherited from a common ancestor?

  7. Explain • Find the part of the tree that shows the relationships between gorillas, chimpanzees, and humans. Notice that there are no lines showing relationships. • Develop three hypotheses to explain how these organisms are related. Make a tree diagram of the hypotheses by drawing lines from point A to each of the three organisms (G=gorilla, C=chimpanzee, H=human, A= common ancestor.

  8. Possible evolutionary relationships Hypothesis 1 Hypothesis 2 Hypothesis 3

  9. Elaborate • Modern research techniques allow biologists to compare the DNA the codes for certain proteins and to make predictions about the relatedness of the organisms from which they took the DNA. You will use models of these techniques to test your hypotheses and determine which one is best supported by the data you develop.

  10. Step 1 Working in groups of four, “synthesize” strands of DNA according to the following specifications. Each different color of paper clip represents one of the four bases of DNA: Black = adenine White = thymine Green = guanine Red = cytosine Each group member will synthesize one strand of DNA. (The first nucleic acid is designated as position 1, the last as position 20) Group member 1 (Human DNA) AGGCATAAACCAACCGATTA Group member 2 (Chimpanzee DNA) AGGCCCCTTCCAACCGATTA Group member 3 (Gorilla DNA) AGGCCCCTTCCAACCAGGCC Group member 4 (Common ancestor DNA) AGGCCGGCTCCAACCAGGCC Elaborate procedure

  11. Elaborate procedure • These strands represent a small section of the gene that codes for the hemoglobin protein. In the case of the common ancestor the sequence is from hypothetical data since no such DNA exists. • Step 2 • Compare the human DNA to the Chimpanzee DNA by matching the strands base by base. • Step 3 • Count the number of bases that are not the same. Record the data in a table. Repeat these steps with human DNA and the gorilla DNA.

  12. Evaluate • How do the gorilla DNA and the chimpanzee DNA compare with the human DNA? • What do these data suggest about the relationship between humans, gorillas, and chimpanzees? • Do the data support any of your hypotheses? Why or why not?

  13. Evaluate Biologists have determined that some mutations in DNA occur at a regular rate and can use this rate as a “molecular clock” to predict when two organisms began to separate from a common ancestor. • Evolutionary biologists often disagree about the tempo of evolutionary change and about the exact nature of speciation and divergence. • Models are useful tools for testing different hypotheses proposed by biologists.

  14. Evaluation procedure • Which DNA is most similar to the common ancestor DNA? • Which two DNAs were most similar in the way that they compared to the common ancestor DNA? • Which of the hypotheses developed previously do your data best support? • Do your findings prove that this hypothesis is correct? Why or why not/

  15. Evaluation procedure • Based on the hypothesis that your data best supported, which of the following statements is most accurate? • Humans and apes have a common ancestor? • Humans evolved from apes? • Based on all of the data collected, which of the following statements is most accurate? • Chimpanzees and humans have a common ancestor. • Chimpanzees are the direct ancestors of humans. • A comparison of many more DNA sequences indicates that human DNA and chimpanzee DNA are 98.8% identical. What parts of your data support this result?