Understanding Gene Expression Control: The Lac and Trp Operons Explained
This comprehensive overview explores the mechanisms controlling gene expression, focusing on two vital operons in prokaryotes: the Lac operon and the Trp operon. It describes how constitutive genes maintain essential functions in all cells, while inducible genes are regulated based on cellular needs. The Lac operon is highlighted for its role in lactose metabolism, detailing its structure, including promoter, operator, and genes involved. Additionally, the Trp operon's regulation through repressors and attenuation is covered, demonstrating the intricate controls governing gene expression in bacteria.
Understanding Gene Expression Control: The Lac and Trp Operons Explained
E N D
Presentation Transcript
Controlling Gene Expression Timothy G. Standish, Ph. D.
All Genes Can’t be Expressed At The Same Time • Some genes are needed for the function of all cells all the time. These genes are called constitutive genes and are expressed by all cells. • Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled in most cells. • For example, beta cells in the pancreas make the protein insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.
Operons Are Groups Of Genes Expressed By Prokaryotes • The genes grouped in an operon are all needed to complete a given task • Each operon is controlled by a single control sequence in the DNA • Because the genes are grouped together, they can be transcribed together then translated together
The Lac Operon • Genes in the lac operon allow E. coli bacteria to metabolize lactose • Lactose is a sugar that E. coli is unlikely to encounter, so it would be wasteful to produce the proteins needed to metabolize it unless necessary • Metabolizing lactose for energy only makes sense when two criteria are met: • Other more readily metabolized sugar (glucose) is unavailable • Lactose is available
The Lac Operon - Parts • The lac operon is made up of a control region and four genes • The four genes are: • LacZ - b-galactosidase - An enzyme that hydrolizes the bond between galactose and glucose • LacY - Codes for a permease that lets lactose across the cell membrane • LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain • Repressor - A protien that works with the control region to control expression of the operon
The Lac Operon - Control • The control region is made up of two parts: • Promoter • These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur • The lac operon promoter also has a binding site for another protein called CAP • Operator • The binding site of the repressor protein • The operator is located down stream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe
Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP Binding Repressor Repressor Repressor mRNA Operator CAP The Lac Operon:When Glucose Is Present But Not Lactose Come on, let me through RNA Pol. No way Jose!
Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP Binding Repressor Repressor Repressor mRNA Repressor Operator CAP The Lac Operon:When Glucose And Lactose Are Present Great, I can transcribe! RNA Pol. Lac This lactose has bent me out of shape Some transcription occurs, but at a slow rate
Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Repressor Operator CAP The Lac Operon:When Lactose Is Present But Not Glucose Bind to me Polymerase Yipee…! RNA Pol. Lac This lactose has bent me out of shape
Alright, I’m off to the races . . . Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Operator CAP The Lac Operon:When Neither Lactose Nor Glucose Is Present Bind to me Polymerase Come on, let me through! RNA Pol. STOP Right there Polymerase
The Trp Operon • Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan • Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. • The trp operon is controlled in two ways: • Using a repressor that works in exactly the opposite way from the lac operon repressor • Using a special attenuator sequence
5-Phosphoribosyl- a-Pyrophosphate Glutamine Glutamate + Pyruvate PPi COO- COO- NH2 -OOC Anthranilate synthetase CH2 O C COO- Anthranilate synthetase (trpE and D) HN N-(5’- Phosphoribosyl) -anthranilate O CH2 -2O3P Chorismate H Antrhanilate O H H HO N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) H H H OH OH OH OH OH OH CO2+H2O -2O3PO CH2 -OOC C C C -2O3PO CH2 C C C OH N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase H H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate C H H H C H H N H N H Tryptophan synthetase (trpB and A) Indole-3-glycerol phosphate -OOC C CH2 Glyceraldehyde- 3-phosphate NH3+ Serine H2O N H N H Tryptophan synthetase Indole Tryptophan The TryptophanBiochemical Pathway
Hey man, I’m constitutive Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor Repressor mRNA Operator Trp Trp Repressor The Trp Operon:When Tryptophan Is Present Foiled Again! RNA Pol. STOP Right there Polymerase
Attenuation • The trp operon is controlled both by a repressor and attenuation • Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes • Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes
5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ Transcription And Translation In Prokaryotes
1 2 3 4 The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator
1 2 1 2 3 3 4 4 The mRNA Sequence Can Fold In Two Ways Terminator haripin
5’ 3’ 3’ 5’ 2 3 Ribosome 4 1 The Attenuator When Starved For Tryptophan RNA Pol. Help, I need Tryptophan
5’ 3’ 3’ 5’ Ribosome 2 3 4 1 The Attenuator When Tryptophan Is Present RNA Pol. RNA Pol.
Control Of Expression In Eukaryotes • Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known • Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site • In addition to controling transcription, there are additional ways in which expression can be controlled in eukaryotes
Eukaryotes Have Large Complex Geneomes • The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA • Because humans are diploid, each nucleus contains 6 3 x 109 base pairs or ≈ 2 m of DNA • That is a lot to pack into a little nucleus!
Eukaryotic DNA Must be Packaged • Eukaryotic DNA exhibits many levels of packaging • The fundamental unit is the nucleosome, DNA wound around histone proteins • Nucleosomes arrange themselves together to form higher and higher levels of packaging.
Highly Packaged DNA Cannot be Expressed • The most highly packaged form of DNA is “heterochromatin” • Heterochromatin cannot be transcribed, therefore expression of genes is prevented • Chromosome puffs on some insect chomosomes illustrate where active gene expression is going on
Only a Subset of Genes is Expressed at any Given Time • It takes lots of energy to express genes • Thus it would be wasteful to express all genes all the time • By differential expression of genes, cells can respond to changes in the environment • Differential expression, allows cells to specialize in multicelled organisms. • Differential expression also allows organisms to develop over time.
Cytoplasm Nuclear pores Degradation AAAAAA AAAAAA DNA Transcription Modification RNA RNA Processing G G Degradation etc. Ribosome mRNA G AAAAAA Export Translation Nucleus Control of Gene Expression Packaging Transportation
Increasing cost Logical Expression Control Points The logical place to control expression is before the gene is transcribed • DNA packaging • Transcription • RNA processing • mRNA Export • mRNA masking/unmasking and/or modification • mRNA degradation • Translation • Protein modification • Protein transport • Protein degradation
A “Simple” Eukaryotic Gene Transcription Start Site 3’ Untranslated Region 5’ Untranslated Region Introns 5’ 3’ Int. 1 Int. 2 Exon 1 Exon 2 Exon 3 Promoter/ Control Region Terminator Sequence Exons RNA Transcript
DNA 5’ 3’ Enhancer Promoter Transcribed Region 3’ 5’ TF 3’ 5’ TF TF RNA Pol. RNA Pol. RNA 5’ Enhancers Many bases TF TF TF
Eukaryotic mRNA 5’ Untranslated Region 3’ Untranslated Region 5’ 3’ G AAAAA Exon 1 Exon 2 Exon 3 Protein Coding Region 5’ Cap 3’ Poly A Tail • RNA processing achieves three things: • Removal of introns • Addition of a 5’ cap • Addition of a 3’ tail • This signals the mRNA is ready to move out of the nucleus and may control its life span in the cytoplasm
The End