1 / 42
Télécharger la présentation

Genomic Pattern Discovery: Comparisons and Alignment

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Recap • 3 different types of comparisons • Whole genome comparison • Gene search • Motif discovery (shared pattern discovery)

  2. Agenda • More about Shared Pattern Discovery • Edit Distance • Recap • What you need to know for the next quiz • Alignment • More details • More examples

  3. Shared Pattern Discovery • I have 10 rats that all have green eyes • I have 10 rats that all have blue eyes • What exactly do the 10 rats have in common that give them green eyes?

  4. Shared Pattern Discovery • Multiple Alignment can be used to measure the strength a genomic pattern found in a set of sequences • First, completely align the 10 green-eyed rats • Then, align green-eyed rats with blue-eyed rats • Finally, compare the statistical difference • Initially, this is how genes were pin-pointed

  5. 95.2%similar 94.7%similar 99.3%similar 99.2%similar Shared Pattern Discovery 99.4%similar 99.2%similar • Multiple alignment of 10 green-eyed rats 94.5%similar 99.1%similar • Alignment of blue-eyed rat and green-eyed rat

  6. Recap: Exact string matching • Its important to know why exact matching doesn’t work. • Target: CGTACGAC • Pattern: CGTACGTACGTACGTTCA • Problem: Target can NOT be found in the pattern even though there is a near-match • Sequences either match or don’t match • There is no ‘in-between’

  7. Recap: Edit Dist. for Local Search • Question: How many edits are needed to exactly match the target with part of the pattern • Target: CGTACGAC • Pattern: CGTACGTACGTACGTTCA • Answer: 1 deletion • Example of local search • Gene finding

  8. Recap: Edit Dist. for Global Comp. • Question: How many edits are needed to exactly match the ENTIRE target the WHOLE pattern • Target: CGTACGAC • Pattern: CGTACGTACGTACGTTCA • Answer: 10 deletions • Example of global comparison (whole genome comparison)

  9. Quiz coming up! • You need to be able to compute optimal edit distance. • You need to fill-in the table.

  10. T C G A C G T C A 0 1 2 3 4 5 6 7 8 9 T 1 2 1 2 1 2 3 4 3 4 5 5 6 7 6 7 8 G 2 A 3 6 3 4 2 7 5 3 4 6 3 2 5 2 2 3 5 4 3 6 1 5 2 4 3 2 3 2 5 4 1 3 3 2 1 5 2 4 3 3 2 2 1 2 2 3 3 5 4 5 3 4 4 6 3 C 4 G 5 T 6 G 7 C 8 Edit Distance – Dynamic Programming Optimal edit distance forTG and TCG 0 Optimal edit distance for TG and TCGA 1 Optimal edit distance forTGA and TCGA Optimal edit distance forTGA and TCG Final Answer

  11. 0 1 2 3 4 5 6 7 8 9 1 0 2 1 1 2 2 3 4 3 5 4 5 6 7 6 8 7 2 1 3 5 6 4 7 2 3 6 3 4 2 5 3 2 3 4 5 2 3 3 5 4 1 2 6 3 2 5 4 1 2 2 3 1 5 3 2 2 2 4 3 3 1 3 2 4 3 2 5 3 6 5 4 3 4 4 5 6 7 8 Edit Distance int matrix[n+1][m+1]; for (x = 0; x <= n; x++) matrix[x][0] = x; for (y = 1; y <= m; y++) matrix [0][y] = y; for (x = 1; x <= n; x++) for (y = 1; y <= m; y++) if (seq1[x] == seq2[y]) matrix[x][y] = matrix[x-1][y-1]; else matrix[x][y] = max(matrix[x][y-1] + 1, matrix[x-1][y] + 1); return matrix[n][m];

  12. This is a gene in the rat genome This is the same gene in the fruit bat This is a totally unrelatedregion of the AIDS virus Why Edit Distances Stinks for Genetic Data? • DNA evolves in strange ways • …TAGATCCCAGATCAGTATTCAAGTTATAC…. • …GATCTCCCAGATAGAAGCAGTATTCAGTCA… • … CCTATCAGCAGGATCAAGTATGTCATACTAC… • The edit distance between rat and virus is smaller thanrat and fruit bat.

  13. Alignment • We need a more robust way to measure similarity • Alignment meets several requirements • It rewards matches • It penalizes mismatches • Different strategies for penalizing gaps • It helps visualize similarity.

  14. Alignment • Two examples • What’s more similar • Seq1 & Seq2, or • Seq3 & Seq4

  15. Alignment • Three steps in the dynamic programming algorithm for alignment • Initialization • Matrix fill (scoring) • Traceback (alignment)

  16. Initialization

  17. Matrix Fill • For each position, Mi,j is defined to be the maximum score at position i,j • Mi,j = MAX [ Mi-1, j-1 + Si,j (match/mismatch), Mi,j-1 + w (gap in sequence #1),      Mi-1,j + w (gap in sequence #2) ]

  18. Matrix Fill • Mi,j = MAX [ Mi-1, j-1 + Si,j (match/mismatch), Mi,j-1 + w (gap in sequence #1),      Mi-1,j + w (gap in sequence #2) ] • Si,j = 1 if symbols match, otherwise • Si,j = 0 • w = 0 (no gap penalty)

  19. Matrix Fill • The score at position 1,1 can be calculated. • The first residue in both sequences is a GThus, S1,1 = 1 • Thus, M1,1 = MAX[M0,0 + 1, M1,0 + 0, M0,1 + 0] = MAX[1, 0, 0] = 1.

  20. Matrix Fill

  21. Matrix Fill

  22. Matrix Fill

  23. Matrix Fill

  24. Tracing Back (Seq #1) A |     (Seq #2) A

  25. Tracing Back (Seq #1) A |     (Seq #2) A

  26. Tracing back the alignment (Seq #1) TA |     (Seq #2)  A

  27. Tracing Back (Seq #1) TTA |     (Seq #2)  A

  28. Tracing Back (Seq #1) GAATTCAGTTA | | || | |     (Seq #2) GGA_TC_G__A

  29. Robust Scoring • Mi,j = MAX [ Mi-1, j-1 + Si,j (match/mismatch), Mi,j-1 + w1 (gap in sequence #1),      Mi-1,j + w2 (gap in sequence #2) ]

  30. Alignment Scoring Alignment score = 8.4

  31. Alignment Scoring Can you find a better alignment?

  32. Alignment Scoring Alignment score = 7.8

  33. Alignment Scoring • Summary: • We have a way of rewarding different types of matches and mismatches • We have a separate way of penalizing gaps • We could choose not to penalize gaps • if we knew that didn’t affect biological similarity • We could even reward some types of mismatches • if we knew they were still biological similarity

  34. Alignment scoring • Process • Experts (chemists or biologist) look at sequence segments that are known to be biologically similar and compare them to sequence segments that are biologically disimilar. • Use direct observation and statistics to develop a scoring scheme • Given the scoring scheme, develop an algorithm to compute the maximum scoring alignment.

  35. Scoring matrix Gap penalty A C G T A 5 -3 -4 -5 -8 C -3 4 -4 -4 G -4 -4 4 -3 T -5 -4 -3 5 Alignment – Algorithmic Point of View • Align the symbols of two strings. • Maximize the number of symbols that match. • Minimize the number of symbols that do NOT match • Gaps can be inserted to improve alignments. • A scoring system is used to measure the quality of an alignment. • In practice: • Scoring matrices and gap penalties are based on biological knowledge and statistical analysis

  36. Local Alignment and Global Alignment • In Global Alignment the two strings must be entirely aligned (every aligned pair of symbols is scored). • In Local Alignment segments from each string are aligned and the rest of the string can be ignored • Global alignment is used to compare the similarity of entire organisms • Local alignment is used to search for genes

  37. Alignment Scoring Revisited • Given a scoring system, the alignment score is the sum of the scores for each aligned pair of symbols plus the gap penalties Local Alignment Total Score = 15

  38. Alignment - Computer Science Perspective • Given two input strings and a scoring system, find the highest scoring local alignment among all possible alignments. • Fact: The number of possible alignments grows exponentially with the length of the input strings • Solving this problem efficiently was an open problem until Smith and Waterman (1980) designed an efficient dynamic programming algorithm • The algorithm takes O(nm) time where n and m are the lengths of the two input strings

  39. Interesting History • The Smith Waterman algorithm for computing local alignment is considered one of the most important algorithms in computational biology. • However, the algorithm is merely a generalization of the edit distance algorithm, which was already published and well-known in computer science. • Converting the edit distance algorithm to solve the alignment problem is “trivial.” • Smith and Waterman are consider almost legendary for this accomplishment. • It is a perfect example of “being in the right place at the right time.”

  40. D[i][j]=MAX( 0, M[i-1][j-1] + S(i,j), M[i-1][j] + w, M[i][j-1] + w); S(i,j) A C G T A 8 -3 -4 -5 C -3 7 -4 -4 G -4 -4 7 -3 0 A 0 C 0 G 0 C 0 Dynamic programming table T -5 -4 -3 8 w -5 A 0 8 3 0 0 G 0 3 4 C 0 T 0 Smith Waterman Algorithm i -4 -5 j -5

  41. Smith Waterman Algorithm

  42. Smith Waterman Algorithm

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer