yosefu
Uploaded by
32 SLIDES
497 VUES
330LIKES

Understanding Translation: The Process of Protein Synthesis in Cells

DESCRIPTION

This overview of translation delves into how mRNA is translated into proteins, a critical aspect of the central dogma of molecular biology. It outlines the roles of mRNA, tRNA, and ribosomes, as well as the importance of the genetic code. Key processes include how tRNA delivers amino acids to the ribosome, where peptide bonds are formed between them. The binding of codons and anticodons, as well as the role of energy in this process, is explained. Finally, the concept of 'wobble' base pairing and practical applications, such as food and exercise effects on protein synthesis, are presented.

1 / 32

Télécharger la présentation

Understanding Translation: The Process of Protein Synthesis in Cells

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Step 2: Translation Section 6.3

  2. In the process of translation in a cell, the transcribed message of mRNA is translated to a totally different ‘language’, that of protein. DNA & RNA are ‘written’ in very similar chemicals, but protein is ‘written’ in an entirely different ‘script’: amino acids. Most commonly, what comes to mind is the process by which we take ideas expressed in one language, & make them intelligible in another language. Often this means a change of script, from one we don’t understand to another we can read. An overview:

  3. For Translation we need: • An ‘edited’ or ‘mature’ mRNA • Ribosomes • An unusual molecule, transfer or tRNA • Lots of available Amino Acids

  4. The overall goal: • Use the DNA message that was copied out into mRNA to produce a polypeptide or protein. • This is the second part of the CENTRAL DOGMA • It relies on the GENETIC CODE.

  5. Translation

  6. The tRNA: • Acts as a ‘taxi’ for Amino Acids • Single stranded, but folded upon itself into a clover-like shape. • Able to bind to Amino Acids at one end, and to mRNA at the other. • The mRNA binding end has an ANTICODON. • Each Anticodon codes for a different Amino Acid.

  7. The tRNA: • Amino acids bind at the 3’ end of tRNA. • This requires some ATP energy! • The Anticodon binds to a complementary codon sequence on the mRNA. • i.e. AUG codon = UAC anticodon

  8. The Ribosome: • Site of translation • Can be free in the cytoplasm, or associated with the R.E.R., Golgi Body, or Nucleolus. • Two Subunits Lg (60S)/Sm (40S) • Able to bind mRNA • Binds tRNA at one of three sites: E (Exit), P (PeptidylAminoacyl) or A (Acetyl Aminoacyl)

  9. The Ribosome: • The mRNA binds in the groove between the large & small subunits. • The first tRNA binds to the P Site. • A second tRNA binds to the A Site. • This brings the amino acids on each tRNA close enough to form a peptide bond. • As the ribosome shifts down the mRNA, the first tRNA is bumped into the E site & is released. • http://highered.mcgraw-hill.com/olc/dl/120077/micro06.swf

  10. The Amino Acids: • During translation, the Amino Acids ‘meet’ at the ribosome • When they are brought close together (on the ribosome), the Amino Group of one reacts with the other’s Carboxyl Group. • In a dehydration synthesis reaction, a peptide bond forms.

  11. Initiating Translation: • mRNA binds to the Ribosome • tRNA’s carrying amino acids arrive, binding anticodon to codon • Peptide bond forms between Amino Acids

  12. Continuing the chain: • The ribosome now shifts 1 codon, moving the first tRNA into the E Site, the second into the P site, and opening the A site for a new tRNA to bind.

  13. Continuing the chain: • Many ribosomes can bind to the same mRNA & translate it simultaneously, amplifying the amount of protein made.

  14. The genetic code How exactly does the base sequence of an mRNA dictate the order of amino acids?? The genetic code

  15. Reading the mRNA: • Codons in the mRNA are ‘read’ in threes • Each three-base combination represents a specific amino acid, & matches a tRNA anticodon • Some amino acids have only one code; others have several • Thus, the code is redundant.

  16. Different forms of the Code:

  17. Different forms of the Code:

  18. Different forms of the Code:

  19. Summary

  20. http://www.youtube.com/user/ndsuvirtualcell#p/a/44B161B3F290FC23/0/5bLEDd-PSTQhttp://www.youtube.com/user/ndsuvirtualcell#p/a/44B161B3F290FC23/0/5bLEDd-PSTQ

  21. How the code works: The DNA Sequence: TAC AAA GCC TAG GAT ACA ATT Is translated to the mRNA sequence: AUG UUU CGG AUC CUA UGU UAA Which in turn encodes the following sequence of amino acids in a polypeptide: MET—PHE—ARG—ILE—LEU—CYS—(stop)

  22. Wrapping things up: • There are three mRNA codons that signal the end of a protein • They are called STOP CODONS: UAA, UAG, UGA • *in DNA, these are ATT, ATC, & ACT. • When it reaches a stop codon, the ribosome releases the mRNA, & translation ends.

  23. Try your hand at this: mRNA Sequence: AUGCCUCGCAAAGGUUGCCACGUAUAA Amino Acid Sequence: MET PRO ARG LYS GLY CYS HIS VAL Stop

  24. “Wobble” base pairing Refers to the fact that the third base in the codon/ anticodon may not actually match

  25. Wobble base pairing • Allows some anticodons to bind to morethanonecodon • Recall the genetic code: Multiple codons for one amino acid. Usually the third base in the codon is what differs. • Helps overcome errors in transcription (no proofreading mechanism)

  26. Practical Applications • “What makes a Firefly Glow?” • demonstration of how protein synthesis is involved • in making a firefly glow • Foods and Protein Synthesis • examples of foods that increase • protein synthesis to support • muscle building • Exercise and Protein Synthesis • discuss the rate of protein • synthesis in relation to exercise

  27. The Central Dogma:Teaching Approach • Protein Synthesis Virtual Lab Transcription and Translation Virtual Lab

  28. The Central Dogma:Teaching Approach • Protein Synthesis Role-Play • Teacher ropes off a designated area as the nucleus where transcription must occur. The rest of the classroom is the cytoplasm where translation will occur. • 8 students are assigned to DNA sequences (24 nucleotides in each) • 8 students are assigned to complementary mRNA sequences • 8 students are assigned to complementary tRNA anticodons with corresponding amino acids (polypeptide chain) • 8 special learning opportunity messages (Ex. “Ribosomes move along the mRNA in a 5’ to 3’ direction, while reading the coding sequence.”) are posted around the classroom corresponding to amino acid polypeptide chains

  29. The Central Dogma:Teaching Approach • Protein Synthesis Role Play Continued • DNA students and mRNA students remain in nucleus during transcription. After transcription, mRNA students move into cytoplasm, where tRNA students are waiting for translation. • DNA students begin by writing down the complimentary RNA sequence to their DNA sequence (transcription). They then search the nucleus for their matching mRNA student. • mRNA student then leaves the nucleus and uses the genetic code to write down the corresponding amino acids to their RNA sequence (translation). They then search the cytoplasm for their matching tRNA student. • The tRNA student then searches for the special message associated with their polypeptide chain, thus completing the task.

More Related