1 / 41
Télécharger la présentation

Cell Division

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Cell Division Mitosis

  2. Why do they have to be so small? • Why not keep growing – why divide? • Surface area to Volume ratio • Too much volume, too little space for it to get in • Diffusion happens at the same rate, but smaller volume means less dist. to travel.

  3. Surface to Volume Ratio 1 cm2 to 1 cm3 4 cm2 to 8 cm3 9 cm2 to 27 cm3

  4. Diffusion happens at the same rate – it all depends on the distance it has to travel.

  5. Now We Know Why, but what • Mitosis is the division of the nucleus • Focus is on getting equal and correct chromosomes to each new cell • Most multicellular organisms are DIPLOID (2n) – two copies of each chromosome • Compared to a haploid cell which only has one copy • What type of cell in our bodies are haploid? Diploid?

  6. What does it look like for humans?

  7. Cell Cycle

  8. Nucleus: full of DNA

  9. Ruptured nucleus

  10. Interphase

  11. Prophase

  12. Metaphase

  13. Anaphase

  14. Telophase/cytokinesis

  15. What Controls Cell Division?

  16. What if it won’t stop? • Cancer is the uncontrolled growth and reproduction of cells • Tumors • Benign (non spreading) • Malignant (spreading) • All depends on access to blood vessels

  17. Viruses and Cancer

  18. Viruses

  19. When Viruses attack • If it goes lytic, then that cell will die • And potentially those surrounding it • When you deal with prophages (lysogenic) it all depends on when it turns lytic and where the DNA inserts • The when often depends on environment • The where depends on the DNA

  20. TTACGACAT GACAGATAC DNA – base pairing • G pairs with C • A pairs with T GACCAGGTCGACCTTATTACGACATGACAGATACCATAGAATGGACAAGG CTGGTCCAGCTGGAATAATGCTGTACTGTCTATGGTATCTTACCTGTTCC

  21. It all Depends on Where Newly inserted viral DNA making a prophage GACCAGGTCGACCTTATTACGACAT GACAGATACCATAGAATGGACAAGG • If it inserts in non-coding DNA, then no big deal • But, if it inserts in the middle of gene, then that gene is no longer functional • Then it just depends on what the gene was.

  22. US Mortality, 2001 No. of deaths % of all deaths Rank Cause of Death • 1. Heart Diseases 700,142 29.0 • 2. Cancer553,768 22.9 • 3. Cerebrovascular diseases 163,538 6.8 • 4. Chronic lower respiratory diseases 123,013 5.1 • 5. Accidents (Unintentional injuries) 101,537 4.2 • 6. Diabetes mellitus 71,372 3.0 • 7. Influenza and Pneumonia 62,034 2.6 • 8. Alzheimer’s disease 53,852 2.2 • 9. Nephritis 39,480 1.6 • 10. Septicemia 32,238 1.3 Source: US Mortality Public Use Data Tape 2001, National Center for Health Statistics, Centers for Disease Control and Prevention, 2003.

  23. Change in the US Death Rates* by Cause, 1950 & 2001 Rate Per 100,000 1950 2001 HeartDiseases CerebrovascularDiseases Pneumonia/Influenza Cancer * Age-adjusted to 2000 US standard population. Sources: 1950 Mortality Data - CDC/NCHS, NVSS, Mortality Revised. 2001 Mortality Data–NVSR-Death Final Data 2001–Volume 52, No. 3. http://www.cdc.gov/nchs/data/nvsr/nvsr52/nvsr52_03.pdf

  24. Cancer Death Rates*, All Sites Combined, All Races, US, 1975-2000 Rate Per 100,000 Men Both Sexes Women *Age-adjusted to the 2000 US standard population. Source: Surveillance, Epidemiology, and End Results Program, 1975-2000, Division of Cancer Control and Population Sciences, National Cancer Institute, 2003.

  25. Cancer Death Rates*, for Men, US, 1930-2000 Rate Per 100,000 Lung Stomach Prostate Colon & rectum Pancreas Liver Leukemia *Age-adjusted to the 2000 US standard population. Source: US Mortality Public Use Data Tapes 1960-2000, US Mortality Volumes 1930-1959, National Center for Health Statistics, Centers for Disease Control and Prevention, 2003.

  26. Tobacco Use in the US, 1900-2000 Per capita cigarette consumption Male lung cancer death rate Female lung cancer death rate *Age-adjusted to 2000 US standard population. Source: Death rates: US Mortality Public Use Tapes, 1960-2000, US Mortality Volumes, 1930-1959, National Center for Health Statistics, Centers for Disease Control and Prevention, 2002. Cigarette consumption: US Department of Agriculture, 1900-2000.

  27. What is Cancer? • Cancer is a disease of old age • It’s typically a build up of mutations in genes that control the cell cycle • We keep seeing more cancer because we live longer

  28. Metastasis – Cancer with car keys

  29. The tumor grows • Mutates genes that promote vessel formation (VEGF) – helps it get food • Forms a displasia (see left) – begins to invade surrounding tissue • Eventually breaks through the blood vessels and spreads

  30. What are some things that play a role in the cell cycle? • Cyclin • VEGF • CDC’s • Telomerase • p53 • Rb • p16ink4a • E2F • Big T, middle T, small T • Ras • Myc • Jun • etc., etc., etc

  31. How can we stop it? • Some of it you can’t – Why? • Mutations happen by accident in ~ 1 in a 1,000,000 replications of DNA • We have over 1 Trillion cells – do the math – they’re (mutations) are going to happen • Be smart – don’t: smoke, drink excessively, get sun burns, etc

  32. How do we treat it? • Surgery, if possible, to remove the tumor • Chemotherapy – Chemical therapy, specifically cytotoxins to go and kill specific cells • Radiation treatment – typically a focused high intensity beam of X-rays which both disrupt cell growth but also and mainly cause blood vessels to thicken and eventually close off

More Related