1 / 52
Télécharger la présentation

translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. translation AgustinaSetiawati, M.Sc., Apt

  2. Pendahuluan DOGMA SENTRAL

  3. PENDAHULUAN • Prosessintesispolipeptidadenganberdasarkodon mRNA

  4. Translation in Pro- and Eukaryotic Cells

  5. Eu- and Prokaryotic Ribosomes Eukaryotic cytoplasm Prokaryotes, Eukaryotic organelles (mitochondria, chloroplasts)

  6. E, P and A Sites of Ribosomes E: Exit site for free tRNA P: peptidyl-tRNA A: aminoacyl-tRNA

  7. Tahaptranslasi • Aktivasi • Inisiasi • Elongasi • Terminasi

  8. Aktivasi • Asam amino teradenilasimenggunakan ATP • Asam amino yang teradenilasibergabungdengantRNAmembentukaminoasiltRNAdikatalisisolehenzimaminoacyltRNAsynthase • Terjadiikatanantaragugus COOH AA tsb dg gugus 3’OH tRNAmelaluiikatanester

  9. Prosesadenilasi - Aktivasi

  10. StrukturtRNA

  11. Redundant Codon

  12. Wobble pairing

  13. Initiation of Translation in Prokaryotes Simple process – involves only initiation factors (IFs) IF-1, IF-2 and IF-3 plus….. fMet-tRNAfMet and mRNA mRNA binds to small ribosomal subunit such that initiator AUG is positioned in the precursor to the P site In eubacteria, such as E. coli, the positioning of the initiator AUG is mediated by base pairing between the ribosome-binding site in the (5’) untranslated region of the mRNA and the 3’ end of the 16S rRNA

  14. Some translational initiation sequences recognized by E. coli ribosomes. Shine-Dalgarno (ribosome binding) sequence: A nucleotide sequence (consensus = AGGAGG) that is present in the (5') untranslated region(s) of prokaryotic mRNAs. This sequence serves as a binding site for ribosomes.

  15. Prokaryotic mRNAs may be polycistronic sites of ribosome ‘re-cycling’ cistron 3 cistron 1 cistron 2 • The ability to bind ribosomes and initiate translation at sites internal to the prokaryotic mRNA allows • genes to be organised into operons, • an operon to be transcribed into a single (polycistronic) mRNA, • the expression of a number of genes (related functions) to be controlled • by a single promoter (or single translational control mechanism)

  16. Initiation of Translation in Prokaryotes

  17. Initiation of Translation in Eukaryotes • major differences to prokaryotic mRNA…… • eukaryotic mRNAs possess a different 5’ ‘cap’ structure • eukaryotic mRNAs are polyadenylated Bases around the initiating AUG influence the efficiency of initiation: RNNNAUGG (‘Kozak consensus’ sequence) Complex initiation factor 53S scansalong mRNA from cap to find initiator AUG

  18. eIF3 eIF2 eIF2 Met Met eIF5 eIF5 GTP GTP eIF1A eIF1A eIF1 eIF1 43S Complex Formation multifactor complex (MFC) eIF1A and eIF3 promote binding of the multifactor complex to the 40S subunit 40S 43S Complex eIF3

  19. ‘Scanning’ Model of Eukaryotic Initiation of Translation (initiating) AUG 5’ ‘cap’ Stop codon open reading frame A(n) me7’Gppp 43S

  20. Initiation of Translation in Eukaryotes (initiating) AUG 5’ ‘cap’ Stop codon ‘scans’ open reading frame A(n) me7’Gppp

  21. Initiation of Translation in Eukaryotes (initiating) AUG 5’ ‘cap’ Stop codon A(n) me7’Gppp

  22. eIF2 eIF2 Met eIF5 GTP GDP eIF3 eIF1 Conformational change, GTP hydrolysis, release of initiation factors, and assembly of the eIF5B GTPase 40S eIF5 eIF3 eIF1 eIF1A m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC GTP hydrolysis by eIF2 requires eIF5 and possibly a conformational change triggered by the Met-tRNAiMet interaction with the 40S subunit 40S GTP Met eIF5B eIF1A m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC

  23. Met Met GDP GTP eIF1A eIF1A Assembly of the 80S ribosome 40S GTP hydrolysis by eIF5B serves as a final checkpoint for correct 80S assembly eIF5B m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC 60S 6 40S eIF5B 6 m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC 60S the 80S ribosome is now poised to elongate

  24. Initiation of Translation in Eukaryotes (initiating) AUG 5’ ‘cap’ Stop codon A(n) me7’Gppp 60S

  25. ELONGATION Abbott and Proud, Trends Biochem.Sci. 29:25 (2004)

  26. The AUG-tRNA-met is now at the P site. The next available codon of the mRNA is now at the A site and the cognate aa-tRNA-eEF1A-GTP binds to it. • The ribosome catalyzes a peptide bond between the methionine at the P site and the new amino acid. However, its tRNA is still at the A site.

  27. ELONGATION

  28. ReaksidalamElongasi Enzimpeptidyltransferase

  29. TERMINATION • Signaled by a stop codon (UAA, UAG, UGA). • Stop codons have no corresponding tRNA. • Release factors (RFs) bind to stop codon and assist the ribosome in terminating translation. • RF1 recognizes UAA and UAG • RF2 recognizes UAA and UGA • RF3 stimulates termination

  30. 4 termination events are triggered by release factors: • Peptidyltransferase (same enzyme that forms peptide bond) releases polypeptide from the P site. • tRNA is released. • Ribosomal subunits and RF separate from mRNA. • fMet or Met usually is cleaved from the polypeptide.

  31. POST TRANSLATION MODIFICATION • General definition: Any modification to the translated form of a protein such as covalent addition, folding and cleaving

  32. POST TRANSLATION MODIFICATION Glikosilasi . Many proteins, particularly in eukaryotic cells, are modified by the addition of carbohydrates, a process called glycosylation. . Glycosylation in proteins results in addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine.

  33. Acylation the addition of an acyl group, usually at the N-terminus of the protein Alkylation The addition of an alkyl group (e.g. methyl, ethyl). Methylation: The addition of a methyl group, usually at lysine or arginine residues. (This is a type of alkylation.)

  34. Lipidation • Prenyl groups • Farnesylation • Geranylgeranylation • attached to Cys at or near C-terminus • Cholesterol • attaches to C-terminal Gly

  35. Phosporilation Folding Diperantaraiolehmolekul:

  36. Protein Folding

  37. Proteins show four hierarchical levels of structural organization: • Primary structure = amino acid sequence Determined by the genetic code of the mRNA. • Secondary structure = folding and twisting of a single polypeptide chain. Result of weak H-bonds and electrostatic interactions e.g., -helix (coiled) and -pleated sheet (zig-zag). • Tertiary structure = three dimensional shape (or conformation) of a single polypeptide chain. Results from the different R groups. • Quaternary structure = association between polypeptides in multi-subunit proteins (e.g., hemoglobin). Occurs only with two or more polypeptides.

  38. struktur protein Praktikum Biologi Molekuler 2009

  39. struktur protein Praktikum Biologi Molekuler 2009

  40. α-helices Praktikum Biologi Molekuler 2009

  41. A-sheet Praktikum Biologi Molekuler 2009

  42. struktur protein Motif (super-secondary structure. Kombinasi  heliks dan  sheet. Motif-motif bergabungmembentuksuatustruktur protein disebut DOMAIN. Praktikum Biologi Molekuler 2009

  43. struktur protein Praktikum Biologi Molekuler 2009

  44. struktur protein Praktikum Biologi Molekuler 2009

  45. Protein Cleavage

  46. Antibiotics that inhibit protein synthesis by binding to ribosomes. Chloramphenicol inhibits peptidyl transferase (PT) activity! Inhibits PT on 80S cytoplasmic ribosomes

More Related