html5-img
1 / 35

Mystery of the

Mystery of the. Matching Marks (Part 3). DNA Search Lab Followup. Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE. Let’s see what it tells us…. RESULTS : Can you see the telomeres?. 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg

carr
Télécharger la présentation

Mystery of the

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mystery of the Matching Marks (Part 3)

  2. DNA Search Lab Followup Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE Let’s see what it tells us…

  3. RESULTS: Can you see the telomeres? 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

  4. RESULTS CLARIFIED: 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcagggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggttagctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtctgtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HeadTelomereof “extra”chrom. 2a HeadTelomereof “short”chrom. 2b FUSION POINT !

  5. Did you know… you’ve got FOSSILS in YOU ! All of you have these fossils,in the #2 chromosome of every cell ! Telo.2a 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggttagctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta Fossils are the remains of ancient life,and these are the telomeres oftwo chromosomes from your ancient ancestor ! Telo.2b So, these telomeres are your very ownMOLECULAR FOSSILS !

  6. CONCLUSION PREDICTIONS: If our hypothesis was true, we should find two telomeresthere;If NOT true, should be NO telomeres there. Did we find telomeres there? YES! Therefore… Our hypothesis was supported:Our #2 chromosome WAS formedfrom the FUSION of two chromosmesin an ancient ancestor after thechimpanzees branched off.

  7. A Peek at the Chromosomesof Other Apes… On the next slide, you will see thechromosome diagrams for humans,chimpanzees, gorillas, and orangutans,all the :”Great Apes”They are shown side by sidefor easy comparison…

  8. The Chromosomesof Humans and ApesCompared For each number,the chromosomesare arranged in this order(left to right):human, chimpanzee,gorilla, orangutan What is moststriking?

  9. RIGHT! They are ALL StrikinglySimilar! And what do we knowwhen we find identicalor very similar patternson different items? RIGHT!They had to have aCOMMON ORIGIN Or, in this case…COMMON ANCESTRY

  10. Based on these chromosome comparisons…Biologists have been able to drawa phylogenetic tree, showinghow primates are related to each other. The following slide shows the tree(called a “Primate Cladogram”).See if you can point to where the COMMON ANCESTORS of Modern Primateswould be LOCATEDon the tree…

  11. Chimps Humans

  12. Chimps Humans Did you find ALLof theCommon Ancestors?

  13. Did you notice… All the other apes had that“extra” chromosome, too? This confirms that this isthe more PRIMITIVE (original)CONDITION, so our SINGLE #2 chromosome is the DERIVED CONDITION (the result of fusion)

  14. MORE CONFIRMING EVIDENCE When we compare primates by using other features,including DNA, different proteins, anatomy, physiology, and fossils,Biologists have developed similarCladograms (Phylogenetic Trees),like these…

  15. Based on Albumin Protein Analysis: Based on DNA Hybridization Analysis See how similarthey are?

  16. Species Today Humans Bonobos 6 mya Chimpanzees 8 mya Gorillas Orangutans 13 mya 18 mya Gibbons Old World Monkeys 25-30 mya Common Ancestor And here’s another one…PRIMATE CLADOGRAMBased on Genome Analysis Again, basically the same pattern

  17. When all the data point to essentially the same conclusions,this strengthens those conclusions. Biologically, humans are very closely related to the apes.In fact, chimps are closer to US,than they are to gorillas! Humans and chimps are even closer than zebras are to horses! Biologists have even recommended thathumans and chimps be in the same genus!

  18. This may be hard for many to accept…But we are very special apes,not just “ordinary animals.” Because of our brain and our dexterity,humans have built amazing culturesand environments not equaledanywhere else in the animal kingdom. Will we use our talents to protect andmanage our environment,or will we get lazy and lose it all?

  19. What will YOU dowith YOUR talentsto make this a better worldfor everyone?

  20. This is YourBEGINNING

  21. LESSON WRAP-UP REALITY-CHECK QUESTIONS MORE DNA SEARCHES

  22. Time for a REALITY CHECK Number your paper from 1-8Based on the observed data…Which are true… which are false? • 1. All chromosomes have telomeres at both ends. • 2. All chromosomes have telomeres in their middles. • 3. Identical complex patterns on different items means they had a common origin. • 4. A hypothesis is a prediction.

  23. REALITY CHECK cont. Which are true… which are false? • 5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor. • 6. Humans evolved from monkeys. • 7. Humans evolved from chimpanzees. • 8. Humans & chimpanzees evolved from a common ancestor.

  24. DID YOU ENJOY THE SEARCH?Here are some more DNA searches • Go online to search a DNA database -See “Chromosome Fusion” for directions (get internet address from teacher) • Look for the “Lost Centromere” - Did you notice that the centromere in the “longer” (lower) chimp chromosome disappeared? Is there any DNA evidence for a centromere still THERE in our #2 chromosome? • Look for telomere DNA on the ends of different chromosomes, different organisms.

  25. END OF LESSON ADDENDUM FOLLOWS More Evidence: Synteny Telomere Tid-Bits

  26. ADDENDUM • More Evidence (Synteny) • Telomere Tid-Bits • Key to “Reality Check” • Extensions: DNA Searching

  27. Confirmation: More Evidence When we compareALL the DNA inour #2 chromosomewith ALL the DNAin the two chimpchromosomes…* we find that it isall the same DNA ! *(this is “synteny”)

  28. However… When we compareALL the DNA inour #2 chromosomewith DNA in Dogchromosomes… we find that our #2is a patchwork of DNAfrom 8 differentDog chromosomes! (WHY?)

  29. WHY? If you said“More time since webranched from our COMMON ANCESTOR with dogs, SO, more time for more chromosome changes and other mutations,” YOU GOT IT!

  30. Telomere Tid-Bits 1. Telomeres apparently protect the endsof our chromosomes, keeping the gene-DNAfrom getting damaged. 2. Each time our chromosomes replicateand cells divide, a little of each telomereis lost, so they get shorter as we age! 3. This is one reason why embryonic stem cellsare preferred over adult stem cells instem cell research.

  31. More Telomere Tid-Bits 4. There is an enzyme, telomerase, that canreplace some of the missing telomere DNA. It’s thought that defective telomerasecould be a cause of aging problems. 5. Telomeres and telomerase are the subjects ofmuch research into cancer, heart disease,brain function, and other problems of aging.

  32. KEY TO REALITY CHECK • 1. All chromosomes have telomeres at both ends. • True • 2. All chromosomes have telomeres in their middles. • False • 3. Identical complex patterns on different items means they had a common origin. • True • 4. A hypothesis is a prediction. • False

  33. KEY TO REALITY CHECK (cont.) • 5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor. • True • 6. Humans evolved from monkeys. • False • 7. Humans evolved from chimpanzees. • False • 8. Humans & chimpanzees evolved from a common ancestor. • TRUE!

  34. EXTENSIONS: DNA SEARCHING 1. For DNA in the 2q13 region online at NCBI, go to: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=AL078621.19 Scroll down about 1/3 scroll bar distance to ORIGIN of segment. Then about 2/3 scroll bar down, to line 108601 for fusion area. 2. To explore ENTIRE chromosome #2, or to see DNA in other chromosomes or chromosomes of other animals, go to http://www.ncbi.nlm.nih.gov/mapview/ Click on the species (Homo sapiens 36 for our chromosomes), then click on the desired chromosome number. Click area of chromosome (or blue line contig) where you want to see the DNA (2q13 in the human chromosome #2 for the fusion area). For detailed directions, see “Chromosome Fusion” lesson:http://www.indiana.edu/~ensiweb/lessons/c.fus.les.html

  35. EXTENSIONS: DNA SEARCHING IDEAS for SEARCHING: Take a look at the DNA in the tip ends (telomeres) of several chromosomes to see the characteristic tandem repeats of ...ttaggg... 2. Look for the missingcentromere area in chromosome #2 where you should see remains of the centromere that was in the longer (lower) ancestral chromosome before it fused to the shorter chromosome. The missing centromere region should be in the 2q21.2 region. 3. Using the BLAST search tool, see if you can find fusion areas in other chromosomes. Do similar searches on the ENSEMBL site at: http://www.ensembl.org/Homo_sapiens/index.html Click on a chromosome; look for Synteny in left column, etc.

More Related