1 / 96

Mystery of the

Mystery of the. Matching Marks. DO I HAVE YOUR ATTENTION?. with BULLETS …. For some reason, a GUNSHOT seems to suggest a CRIME SCENE …. and BULLET MARKS …. How are these marks used to solve crimes ?. RIGHT! They are used to COMPARE

jason-gilbert
Télécharger la présentation

Mystery of the

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mystery of the Matching Marks

  2. DO I HAVE YOUR ATTENTION? with BULLETS… For some reason, a GUNSHOT seems to suggest a CRIME SCENE… and BULLET MARKS…

  3. How are these marks used to solve crimes?

  4. RIGHT!They are used to COMPARE bullets found at a crime scene,with bullets that werefired from suspect guns

  5. Here are the marks from a crime scene bullet…

  6. and here are the marks from bullets fired from four possible suspect guns… A B C D

  7. Which bullet matches the crime scene bullet? Crime Scene: A

  8. Which bullet matches the crime scene bullet? Crime Scene: B

  9. Which bullet matches the crime scene bullet? Crime Scene: C

  10. Which bullet matches the crime scene bullet? Crime Scene: D

  11. RIGHT! It’s a bullet shot from gun C.So what does that tell us? Crime Scene: C

  12. YOU’VE GOT IT! The Crime Scene bullet and bullet C came from the SAME GUN ! Crime Scene: C We could say the bullets had a “Common Origin”

  13. Many studies have told us that when any two items with COMPLEX PATTERNSMATCHEACH OTHER perfectly, we can be confident that they had a… COMMON ORIGIN !

  14. KEEP THIS IN MIND:When we find otherCOMPLEX PATTERNS that MATCH,What does this tell us? They had a… “COMMON ORIGIN” This is our theme:Matching Complex Patterns = COMMON ORIGIN

  15. What is this?

  16. Right, it’s a HUMAN KARYOTYPE

  17. A Human Karyotype has photos of all the matched pairs of human chromosomes from one cell, stained to show banding patterns, and arranged from long to short, with centromeres near the top.Here are our numbers 6-9…

  18. On the next slide, you will seeanother kind of human karyotype:It has diagrams of the chromosomes, with onlyone member of each pair, clearly showing their banding patterns…

  19. And on the next slide, you will see a similar diagrammatic karyotype, but this is from a NON-HUMAN SPECIES…

  20. NEXT, we wll see both karyotypes together,showing the matching chromosomesside by side: each human chromosome is on the left… each NON-human chromosome is on the right As you COMPARE the CHROMOSOMES,side-by-side, what is MOST surprising?

  21. What is most surprising?

  22. Did you notice how very SIMILAR they are? Here’s a closer look at the first seven: Any identical ones? What did we say about items with IDENTICAL COMPLEX PATTERNS?

  23. RIGHT!Identical Patterns = COMMON ORIGIN How would this applyto two different SPECIESwith IDENTICAL banding patternson their CHROMOSOMES? RIGHT!They MUST have a Common Origin, or a COMMON ANCESTOR !

  24. Time for a Revelation… The non-human species is the CHIMPANZEE The clear chromosome evidenceof identical banding patternstells us that humans andchimpanzees must have had a…

  25. COMMON ANCESTOR ! Somewhere, in our distant past,there was an ape-like species thatgave rise to two lines of ancestry.One branch led to modern CHIMPS, the other branch led to HUMANS. Chimps Us NOW 6 mya <---Common Ancestor DNA analysis and fossils tell us thatthis split was around 6-7 million years ago (6-7 mya)

  26. That’s pretty strong stuff... And seems to conflict with Traditional Views! Is there any other evidence that supports this conclusion? Let’s take another look at thosechromosomes… [next set of slides]

  27. Mystery of the Matching Marks part 2

  28. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT from the human chromosomes (on the left)?

  29. How are they different?

  30. GOOD EYES!- Chimp’s #2 is shorter than our #2-Chimp has an extra unmatched chromosome What could have happenedto cause those differences? Let’s take a closer look at those chromosomes…

  31. “Missing” part “Extra” in chimps ANY IDEAS that might EXPLAIN the “missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”chromosome?

  32. Maybe the chimp’s“extra” chromosomewas once part of itsshort #2. Could the “extra”chromosome match the upper part ofour #2? LET’S TRY IT…

  33. Nope!They don’t seemto match.What else couldwe try? Turn the “extra” oneupside down?! Let’s try it…

  34. WOW !IT WORKED! They DO MATCH! NOW, the next question:“How could this happen?” • Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR • Were there TWO shortchromosomes in our ancestor that fused (joined) to make ONE in humans?

  35. We DO have a PROBLEM: “How did this difference happen?” And, we have two hypotheses(possible explanations): 1. Onesplit to make two, OR 2. Twofused (joined) to make one Let’s try the second one (fusion). How can we TEST that hypothesis?

  36. We could look for evidence offusion in the middle of our#2 chromosome… But, what kind of evidence can we look for? Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

  37. CHROMOSOME PARTS HeadTelomere All Chromosomes have telomeres at bothends(like shoelace aglets!) Centromere TailTelomere Telomeres have a special DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

  38. Did you notice the repeated sequence: ttaggg? HeadTelomere DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Centromere TailTelomere “ttaggg” is repeated 800-1600 times in each Telomere

  39. Here’s another view ofa chromosome,showing the telomeresuntwisted, and their typicalDNA sequence It also shows that theupper (shorter) armabove the centromereis called the “p-arm”, andthe lower (longer) arm iscalled the “q-arm”

  40. TELOMERE DNA CLOSE-UP Here are ends of the uppertelomeres of thechimp’s “short”chromosome (left)… and its “extra”chromosome (right) Short #2 “Extra”

  41. NOTICE! When we turn the “extra”chromosome upside-down,and try to connect it to the“short” chromosome, it onlyFITS one way (left)… They do NOT fitwhen one telomere istwisted 180o (right)

  42. FURTHERMORE…When we lay the fusion area on its side,we can see more clearly how the DNA sequencechanges at the fusion point. Reading the top strand only, see:T T A G G G C C C T A A

  43. THAT’S WHAT YOU WILL BE LOOKING FORWhen you are searching the DNA for theFusion Point, you will be lookingat only one strand of DNA (since the “lower” strand is the predictablecomplement of the “upper” strand).Look for something like this: …ttagggttagggttagggccctaaccctaaccctaa… Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,and multiple c’s (and no g’s) BEGIN?

  44. What would this point be called?(where multiple g’s stop, andmultiple c’s begin) This would be the FUSION POINTRaise your hand when you see that point in this actual DNA strand below: On which line does the change happen?

  45. Maybe this will show itmore clearly: THERE’S the FUSION POINT ! GOT THE PICTURE?

More Related