liang
Uploaded by
33 SLIDES
712 VUES
340LIKES

Mystery of the

DESCRIPTION

Mystery of the. Matching Marks. part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES : What do you see in the chimp chromosomes (on the right ) that is DIFFERENT from the human chromosomes (on the left )?.

1 / 33

Télécharger la présentation

Mystery of the

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Mystery of the Matching Marks part 2

  2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT from the human chromosomes (on the left)?

  3. How are they different?

  4. GOOD EYES!- Chimp’s #2 is shorter than our #2-Chimp has an extra unmatched chromosome What could have happenedto cause those differences? Let’s take a closer look at those chromosomes…

  5. “Missing” part “Extra” in chimps ANY IDEAS that might EXPLAIN the “missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”chromosome?

  6. Maybe the chimp’s“extra” chromosomewas once part of itsshort #2. Could the “extra”chromosome match the upper part ofour #2? LET’S TRY IT…

  7. Nope!They don’t seemto match.What else couldwe try? Turn the “extra” oneupside down?! Let’s try it…

  8. WOW !IT WORKED! They DO MATCH! NOW, the next question:“How could this happen?” • Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR • Were there TWO shortchromosomes in our ancestor that • fused (joined) to make ONE in humans?

  9. We DO have a PROBLEM: “How did this difference happen?” And, we have two hypotheses(possible explanations): 1. Onesplit to make two, OR 2. Twofused (joined) to make one Let’s try the second one (fusion). How can we TEST that hypothesis?

  10. We could look for evidence offusion in the middle of our#2 chromosome… But, what kind of evidence can we look for? Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

  11. CHROMOSOME PARTS HeadTelomere All Chromosomes have telomeres at bothends(like shoelace aglets!) Centromere TailTelomere Telomeres have a special DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

  12. Did you notice the repeated sequence: ttaggg? HeadTelomere DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Centromere TailTelomere “ttaggg” is repeated 800-1600 times in each Telomere

  13. Here’s another view ofa chromosome,showing the telomeresuntwisted, and their typicalDNA sequence It also shows that theupper (shorter) armabove the centromereis called the “p-arm”, andthe lower (longer) arm iscalled the “q-arm”

  14. TELOMERE DNA CLOSE-UP Here are ends of the uppertelomeres of thechimp’s “short”chromosome (left)… and its “extra”chromosome (right) Short #2 “Extra”

  15. NOTICE! When we turn the “extra”chromosome upside-down,and try to connect it to the“short” chromosome, it onlyFITS one way (left)… They do NOT fitwhen one telomere istwisted 180o (right)

  16. FURTHERMORE…When we lay the fusion area on its side,we can see more clearly how the DNA sequencechanges at the fusion point. Reading the top strand only, see:T T A G G G C C C T A A

  17. THAT’S WHAT YOU WILL BE LOOKING FORWhen you are searching the DNA for theFusion Point, you will be lookingat only one strand of DNA (since the “lower” strand is the predictablecomplement of the “upper” strand).Look for something like this: …ttagggttagggttagggccctaaccctaaccctaa… Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,and multiple c’s (and no g’s) BEGIN?

  18. What would this point be called?(where multiple g’s stop, andmultiple c’s begin) This would be the FUSION POINTRaise your hand when you see that point in this actual DNA strand below: On which line does the change happen?

  19. Maybe this will show itmore clearly: THERE’S the FUSION POINT ! GOT THE PICTURE?

  20. NOW…WHERE should we LOOKfor theFUSION POINT? 2a YES!Right in the MIDDLEof our chromosome #2,where the two matchingchimp chromosomesoverlap ! 2b

  21. This would be BELOW theCENTROMERE, in the “q-arm” of the chromosome,in the region known as“2q13”,shown in red. 2a 2b (Can you figure out wherethe number “2q13”comes from?)

  22. (OPTIONAL) For “2q13”… 2 = chromosome #2 q = the q-arm 1 = region 1 of that arm 3 = sub-part 3 of that region 2a 2b

  23. So, where can we see the DNAfrom this region of our#2 chromosome to examine? I have gone to an online DNA databaseand printed out the DNA in that region. You could do this yourself, but, to savetime, I’ve done that for you…

  24. This 2q13 region gives us 52 pages of DNA! This is what a page looks like… On this page, there are 57 lines, each line with60 bases (letters),and that gives us…3,420 bases per page!

  25. If these 52 pageswere attachedend-to-end,they would stretchabout 14 meters(16 yards) aroundyour room!AND… If ALL the DNA from ourENTIRE #2 chromosomewas printed out like this,it would stretch about16 km (10 miles)!

  26. By the way… Each number on the left edge equals the number of the first base (letter)on that line. And, a space has been inserted after every 10th base (letter)to make counting easier.

  27. You may notice when you are searching, that the “ttaggg” pattern is not perfect! An occasional “c” slips in here and there, and you will see other minor “glitches.” WHY? If you said “MUTATIONS,” you would be right.

  28. NOW, it’s YOUR turn! You get to SEARCH those 52 pages! Are you ready??? Just kidding!Actually, you will formteams of 3-4, andeach team gets thesame 4 pages (from the “2q13” region)

  29. One of those 4 pagesshould have the“Fusion Area” Each person looks forthat “Fusion Area” ona different page. When one of you findsit, show your partners. Discuss your discovery with your partners, and answer the questions on your “SEARCH” worksheet

  30. RECAP PROBLEM: How did our #2 chromosomecome to look identical to two chromosomesin chimpanzees” Chimp Us HYPOTHESIS: our #2 chromosome was formed by the fusion oftwo chromosomes in an ancestor, after chimps branched off. Fusion? <--Common Ancestor TEST: Look for fusionevidencein the form of telomere DNAin the middle of our #2chromosome PREDICTIONS: If hypothesis is true, we should find two telomeres there;If NOT true, should be NO telomeres there.

  31. GOSEARCHfor theTell-Tale Telomeres !

  32. Students get into teams now,and pick up team folder with 4 DNA pages per team, and1 worksheet per student. Go to MMM2 for followup slides, to show after teams find fusion points, or to show optional DNA models of telomeres.

More Related