1 / 33

Deoxyribonucleic A cid- DNA

Discover the incredible role of DNA in building and controlling every aspect of your body, from physical appearance to genetic information transmission. Explore the process of DNA replication and understand the significance of base-pairing rules. Learn about the pioneering work of Watson and Crick and the fascinating world of enzymes and catalysts in DNA synthesis.

cjeanne
Télécharger la présentation

Deoxyribonucleic A cid- DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DeoxyribonucleicAcid- DNA

  2. DNA tells bodies how to grow.

  3. DNA: An Instruction Manual for Building a Body • Building a person involves following a set of instructions. • Your body stores those instructions in a long, twisted molecule, DNA. • It controls everything about the way you look, from the color of your eyes to how tall you are to the width of your feet. • You carry billions of copies of those DNA instructions.

  4. DNA • The primary function of DNA is to store and transmit genetic information that tells cells which proteins to make and when to make them.

  5. DNA • Polymers are complex molecules composed of repeating subunits. • The repeating subunits in DNA and RNA are called nucleotides.

  6. Watson and Crick • In 1953, James Watson and Francis Crick proposed a model for the DNA molecule that consisted of two nucleotide chains that wrap around each other to form a double spiral. • This shape is called a double helix.

  7. Watson and Crick

  8. Watson and Crick

  9. Watson and Crick

  10. Break Time • Asking for help is sometimes very hard, but people are always willing to help those in need.

  11. Break Time • Asking for help is sometimes very hard, but people are always willing to help those in need. • Get help before it is to late!

  12. DNA is a complex molecule found in all living things.

  13. You think your nano is cool!

  14. You think your nano is cool!

  15. DNA

  16. Each nucleotide is composed of: 1. A Sugar: Deoxyribose - a 5-carbon sugar in DNA Ribose - a 5-carbon sugar in RNA. This sugar has more oxygen than the sugar in DNA.

  17. Each nucleotide is composed of: 2. One of these four nitrogen bases: Purines - have a double ring of carbon and nitrogen atoms. • Adenine • Guanine Pyrimidines - have a single ring of carbon and nitrogen atoms. • Thymine • Thymine is replaced by uracil in RNA. • Cytosine

  18. Each nucleotide is composed of: 3. A phosphate group - PO4

  19. What is it? GGCACGAGGGTAAATATGGCATAAGTTAATAACA CTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGG GTCTGATGGGGAGAAGGAGAACGTATCATCCTAGC TTCCTCTCTTAATAAACCTAGAAAAACGGGTAGTA AACTGTGGATAGTCAGGAAAACACCCAGCAAGGGA CACAGC TGTCAGGAAATGAATCTTCCCCCCAACCC CCACCATGCAGATGGATAGACAGAATCTTTCCTGA CTAGTCATTAGGATCAGGGGCCTCTGTTGGATTTGT GTTTCTTGAAGAATAGCTGGCAGAGTGGTATAAAA GACACGAATATCTCCTGGTCTATAAGGATACTCTGA TTTGGGGTTTGCATTTTTCATGGTTTTTATTTCCTGT TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG

  20. Break time • You must accept the truth even if it changes your point of view, or hurts.

  21. Break time • Sometimes it just hurts!

  22. Base-pairing rules • Base-pairing rules:these rules describe the behavior of the bases.

  23. Base-pairing rules • Base-pairing rules:these rules describe the behavior of the bases. • Cytosine always bonds with guanine by forming three hydrogen bonds.

  24. Base-pairing rules • Base-pairing rules:these rules describe the behavior of the bases. • Cytosine always bonds with guanine by forming three hydrogen bonds. • Adenine always bonds with thymine by forming two hydrogen bonds. • A pair of bases that always bond together is known as a complementary base pair. • Hydrogen bonds hold bases together

  25. Enzymes and Catalyst • Catalyst-something that speeds up a chemical reaction. • Example- fire • Enzyme- A protein that acts as a catalyst within the body. • If a word ends with “ase”, its probably an enzyme. • Example- Amylase in saliva

  26. Replication • Replication-the process of duplicating the DNA molecule. • Why does DNA replicate?

  27. Replication • The process in which DNA is copied by using each of the strands as a template for a new strand. • Because with each round of DNA synthesis the new DNA consists of one newly synthesized strand and one parental strand, the process of DNA replication is called semiconservative.

  28. REPLICATION OF DNA • DNA replication begins with a partial unwinding of the double helix at an area known as the replication fork. • This unwinding is accomplished by an enzyme known as DNA helicase. • As the two DNA strands separate and the bases are exposed, the enzyme DNA polymerase moves into position at the point where synthesis will begin.

  29. REPLICATION OF DNA • The DNA polymerase then adds nucleotides one by one in an exactly complementary manner, A to T and G to C. • Since each new strand is complementary to its old template strand, two identical new copies of the DNA double helix are produced during replication.

More Related