1 / 12

Netrin-1 Effects on Axonal Growth in Spiral Ganglion Neurons

Study on Netrin-1's impact, guided by the DCC gene, on axonal orientation & growth in adult ear neurons. Methods: Mouse & chicken tissues used. Aim: Determine effects of Netrin-1 on axonal guidance in Spiral Ganglion. Results indicate potential for directed neurite outgrowth.

Télécharger la présentation

Netrin-1 Effects on Axonal Growth in Spiral Ganglion Neurons

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Sistemas SensoriasProf. M.D. Ph.D. FayezBahmadJr Mestrando Leonardo Costa Pereira

  2. Introdução

  3. Introdução Crescimento Aleatório Carcinoma (DCC) + Netrin 1

  4. Objetivo • Determinar os efeitos de Netrin 1, guiados pelo gene DCC, quanto a orientação e crescimento do axônio do neurônio situado no Gânglio Espiral, em uma orelha adulta.

  5. Material e Métodos • O presente estudo utilizou-se de tecidos de camundongos e os gânglios acústicos de galinhas. • Os Prime’s (By PCR) • 5!AGTSTGTCTCAACTGCCGCC3! (netrin-1 sense) • 5!TACACGGAGATGATGTTCACGG3! (netrin-1 antisense) • 5!AGTGCCTCTCATTCAGGTCAGG3! (DCC sense) • 5!TCACAGACTGAGTTCTTCCTGC3! (DCC antisense)

  6. Material e Métodos

  7. Material e Métodos • As células do gânglio coclear foram micro dissecadas. • Trituradas e fixadas em laminas histológicas • Fixação do gene DCC após 48h • 120h de cultivo dos neurônios • 2 grupos (Controle X Netrin 1 + Gene DCC.

  8. Resultados

  9. Resultados

  10. Discussão

  11. Conclusão • O Netrin 1, pode promover uma neurite orientada dos axônios do Gânglio Espiral, em modelo in vitro.

More Related