1 / 1

TS 3'UTR

C. A. DHFR 3'UTR. 1.2. 1. 0.8. **. 0.6. Relative luciferase activity. 0.4. 0.2. 0. control. mutant. wild type. vehicle control. vehicle control. miR control. miR control. TS 3'UTR. miR-215. miR-215. kDa. 1.2. -. -. DHFR. 21. 1. 0.8. -. -. **.

dragon
Télécharger la présentation

TS 3'UTR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. C A DHFR 3'UTR 1.2 1 0.8 ** 0.6 Relative luciferase activity 0.4 0.2 0 control mutant wild type vehicle control vehicle control miR control miR control TS 3'UTR miR-215 miR-215 kDa 1.2 - - DHFR 21 1 0.8 - - ** Relative luciferase activity TS 36 0.6 ** 0.4 - a-Tubulin - 50 0.2 0 HCT 116 (wt-p53) U-2 OS mutant control wild type-1 wild type-2 534-555 of DHFR 3’UTR 5’…AGCAGTGTATTTGCTAGGTCAT Has-miR-215 3’ CAGACAGUUAAGU-AUCCAGUA 84-104 of TS 3’UTR 5’…AAGAAAAAGGAACTAGGTCAA Has-miR-215 3’ CAGACAGUUAAGUAUCCAGUA 216-236 of TS 3’UTR 5’…ATCTGACAATGCTGAGGTTAT Has-miR-215 3’ CAGACAGUUAAGUAUCCAGUA B

More Related