elina
Uploaded by
59 SLIDES
2712 VUES
1280LIKES

Biotechnology

DESCRIPTION

Biotechnology. bios = life technos = tool logos = study of Biotechnology = The Study of Living Tools. 1. Timeline. 4000 BC Egyptians use yeasts for bread and wine 1750 BC Sumerians brew beer 1500 AD Aztecs make cakes from Spirulina algae 1917 Biotechnology term coined

1 / 59

Télécharger la présentation

Biotechnology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biotechnology bios = life technos = tool logos = study of Biotechnology = The Study of Living Tools

  2. 1. Timeline • 4000 BC Egyptians use yeasts for bread and wine • 1750 BC Sumerians brew beer • 1500 AD Aztecs make cakes from Spirulina algae • 1917 Biotechnology term coined • 1972 Hamilton Smith discovers first restriction enzyme • 1973 Stanley Cohen made first transgenic organism with gene from African clawed toad into bacteria • 1978 Louise Brown, first test tube baby born • 1981 PCR Invented by Kary Mullis Genentech releases (Humulin) human insulin • 1984 PCR used by Alec Jeffries in DNA fingerprinting EPA approves release of genetically engineered tobacco • 1990 Pfizer introduces Chymosin (Rennin) • Michael Crichton’s Jurassic Park published • 1993 FDA approval of Monsanto’s rBGH/rBST • 1994 Calgene introduces Flavr-Savr Tomato • 1995 O.J. Simpson Trial • 1996 Sequence completed for S. cervisiae • 1997 Cloning of Dolly at Roslin Institute • 1998 First animal genome sequenced: C. elegans James Thompson (UW-Madison) develops procedure for culturing stem cells 40 million hectares of GM crops planted globally (soy, cotton, canola, corn) • 1999 ‘Golden Rice’ developed • 2000 First Plant Genome Sequenced – Arabidopsis thaliana • 2001 Drosophila genome published First cloned cat – “carbon copy” • 2003 Completion of Human Genome Project • 2005 Rice Genome Sequenced • 2007 GM meat approved for use

  3. Selective Breeding a. Luther Burbank • disease resistant Burbank potato • fight blight, etc in Ireland b. Norman Borlaug of International Maize & Wheat Research Center in Mexico (received Nobel Prize) • Crossed short-stemmed wheat with Mexico’s best wheat • Gov’t of India requested seeds, as tall wheat plants falling over • Increased wheat production from 12 million metric tons in 1965, to 20 million in 1970, 37 million in 1982 c. Hybridization • Dissimilar individuals mate to hope to get desired traits • Burbank: Popular Shasta Daisies d. Inbreeding • Keep desired traits • Brings recessive traits too (joints in golden retrievers)

  4. Increasing Variation a. Inducing mutations in bacteria • Radiation, chemicals, r-strategists • Can clean up oil spills (bioremediation) b. Polyploidy (extra chromosomes) • Usually fatal in animals • Bigger, stronger, sexier plants (bananas, citrus fruits, day lilies)

  5. DNA Manipulation 1. Cutting & Separating a. Restriction Enzymes • Proteins from bacteria that cut DNA at specific points • Cut at palindromes • Evolved as viral defenses • Can have blunt or sticky ends • Can be spliced into DNA cut with same RE Naming of EcoR1: E from genus of organism where found (Escheria) co first 2 letters of species name (coli) R Strain (RY13) 1 Order discovered

  6. Restriction Enzymes

  7. (Cutting & Separating, Cont’d) b. Gel Electrophoresis • Migration of charged particles under electric field • DNA has negatively charged phosphate ends • (-) electrode repels DNA, (+) electrode attracts DNA • 1% agarose gel (natural colloid from seaweed) • agarose is convoluted – like a sieve • TBE solution is electrolytic solution • Migration of DNA molecules move through gel at different rates (bigger = slower, smaller = faster) • DNA is stained to see bands (Ethidium Bromide) • Usually a marker is used (of known fragment sizes)

  8. Equipment

  9. Digest & Separation

  10. (Cutting & Separating, Cont’d) c. Restriction Mapping • Use of various restriction enzymes • Gel digests show size of fragments • Patterns of digests can create restriction map • pUK 1 plasmid: Gel Digest Restriction Map

  11. Restriction digest of plasmid DNA from Escherichia coli • run on a 1% agarose gel and stained with ethidium bromide • Lane 1 (far left) is a kilobase DNA ladder • Lane 2 is the uncut plasmid DNA • Lane 3 is a single digestion of the plasmid with the EcoRI • Lane 4 is also a single digestion, but with XhoI • Lane 5 (far right) is a double digestion - both EcoRI and XhoI

  12. DNA Manipulation, Cont’d 2. Identifying Genes - Southern Blot (named after Ed Southern) a. DNA cut with RE’s b. Separated by Gel Electrophoresis c. DNA “blotted” to filter paper and probe is added d. Only DNA fragments with identified gene bind to probe

  13. Southern Blot

  14. DNA Manipulation, Cont’d 3. Nucleotide Sequencing (fluorescent dye-terminator cycle sequencing) a. Unknown Single Stranded DNA put in test tube b. DNA polymerase and nucleotide bases (dNTP’s) added c. Small number of bases with flourescent dye attached (ddNTP’s) d. Each time dye-labeled nucleotide binds to fragment, synthesis stops e. Ultimately yields DNA strands of different lengths f. Separated (by gel electrophoresis) g. Color of bands tells sequence (read by laser detector, computer software analyzes)

  15. Laser Readout

  16. ABI Prism

  17. DNA Manipulation, Cont’d 4. Making Copies (Polymerase Chain Reaction or PCR) a. Small amount of double stranded DNA b. Heated to separate, then cooled c. Add DNA polymerase*, primers (short pieces of artificial DNA), and free nucleotides • *Taq polymerase (from Thermophilus aquaticus) • Isolated from hot springs in Yellowstone • Can withstand hot temperatures d. DNA poly attaches nucleotides to primers e. REPEATED many times (5 minute cycles) f. Use of a thermal cycler

  18. DNA Manipulation, Cont’d 5. Recombinant DNA a. Use RE’s to cut out gene b. Cut host DNA with same RE c. Need a vector to incorporate into host d. Screen for effective transfer e. If successful, then results in Transgenic Organism f. First done by Steven Howell by inserting luciferase gene (for glowing) from firefly into tobacco plant g. Transgenic Organisms 1. Bacteria • Transformation with plasmid • Plasmid: ring of DNA used to transfer genes

  19. 2. Plants • Bacterium • Has small DNA plasmid causes tumors • Inactivation of tumor gene • Insertion of foreign DNA • May uptake DNA if cell walls removed • Gene gun! 3. Animals • Viral vectors

  20. 4. Nuclear Transfer • Can inject DNA into large egg nuclei • Enzymes used to repair and recombine DNA in cell help insert foreign DNA

  21. 5. Scientists may also insert marker gene to tell if procedure worked • ampicillin resistance (bacteria then grown on nutrient medium with ampicillin) • glowing gene from jellyfish (produces GFP) To determine what turns on color in wings, University of Buffalo (NY) biologists inserted a marker gene from jellyfish into African butterflies resulting in fluorescent green eyes

  22. Using Glowing Markers Fruit Fly Embryo Glowing Tobacco!!

  23. 6. Knockout Mice • Scientists transfer a defective version of a gene they want to study into stem cells • The defective gene “knocks out” the normal gene, and scientists can examine the effects of the disabled gene on the resulting young mouse. • Using gene targeting, researchers can transfer human disease genes into embryonic stem cells to make mouse models of many human ailments

  24. 7. Whole Genome Analysis • Allows analysis of multiple genes in various conditions • “Complexity does not come from the number of genes, but from the way in which they are used” (Gerald Rubin, HHMI VP) • Gene Chips (Affymetrix) • ½ square inch glass with short DNA fragments • ~$200,000 each • Microarrayer • Robot designed by Patrick Brown @ Stanford • Can analyze 6,000 genes in yeast simultaneously • ‘Make your own’ for $25,000

  25. A Microarrayer Shows How Genes in a Yeast Cell Respond to Different Types of Stress http://www.hhmi.org/genesweshare/a110.html

  26. US GOV vs. Celera Genomics

  27. Uses 1. Human Genome Project a. Attempt to map all of human genome! b. Begun in 1999, working draft Feb. 2001, finished 2003 (3 years ahead of schedule!) c. Collaboration of 20 labs in 6 countries d. Competition with Craig Ventnor, Celera Genomics e. Discoveries • 3.2 billion base pairs • only 30-40,000 genes • over 120,000 unique mRNA molecules • only 1-1.5% of human DNA codes for proteins • Each cell has 6 ft of DNA = 1 inch of exons to be transcribed • Most of genome is “Junk DNA” • Genes not evenly distributed • Chromosome 19 packed with genes • Large chromosomes 4 & 8 have few transcribed genes

  28. Types of Genetic Maps

  29. pGLO Plasmid Map

  30. pGLO Sequence ATCGATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTGCAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCTAATTCTCATGTTTGACAGCTTATC

  31. 2. DNA Fingerprinting a. History • Lynda Mann in England • Raped and Murdered, Nov. 22, 1983 • Local dishwasher questioned & pleads guilty to similar case • Alec Jeffries uses new method of PCR for identification, exonerates dishwasher of both crimes • Every man in area ‘fingerprinted’ by DNA, no matches • Colin Pitchfork finally caught and tested positive (friend went in to fake test for him) • Plant Witness • Murder case in Phoenix, Arizona • Pager found at crime scene led police to suspect (said that victim had robbed him) • Palo Verde pods in truck yielded DNA that matched with trees at crime scene

  32. b. Uses • Identification and exoneration of rapists, criminals • Paternity cases (Jefferson/Sally Hemmings) • Identification of body parts • Supposed heart of Louis XVIII (child king who died in prison) compared to hair from Marie Antoinette • ID of bodies in mass graves in Guatemala (from civil war) • Genetic testing (blood stain on Lincoln’s jacket tested for Marfan’s syndrome) • Migration patterns • ID tags for children, pets • ID of endangered/protected species • Food authentication, such as in wine and caviar • Authentication of official 2000 Summer Olympic goods (sections of DNA taken from several unnamed Australian athletes added to ink used to mark all items)

  33. National Geographic March 2006

  34. c. Use of RFLP’s (restriction fragment length polymorphisms) • Procedure • Restriction enzymes cut DNA differently • Fragments separated with GE • Probed and exposed to X-ray film • Screening for Sickle Cell Anemia • Point mutation of CAG (betaA gene) to CTG (betaS gene) = SNP or single nucleotide polymorphism • Produces valine instead of glutamic acid in hemoglobin molecule • RE’s cut DNA differently • Probe attaches to specific sequence • Affected = large fragment • Pedigree shows family; son with sickle-cell anemia • Electrophoresis pattern below each child

  35. RFLP

  36. d. DNA Typing • Small percentage of DNA different from person to person (less than 1/10th of 1%) • Variable regions used for comparison Gel Lanes MARKERS VICTIM EVIDENCE #1 (semen stain left on the victim's clothing) EVIDENCE #2 (semen from the vagina of the rape victim) SUSPECT #1 SUSPECT #2 CONTROL (check to see if probes are working) • Results • Suspect #2 can be clearly ruled out • Suspect #1 MAY be guilty (probability that 6 alleles match is 1 in 4056) • Suspects NOT picked at random: Evidence used in conjunction with • More probes (alleles) the better: 14 = chance of match is 1 in 268 million

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer