fitzgerald-trevino
Uploaded by
27 SLIDES
392 VUES
270LIKES

String Matching

DESCRIPTION

This article explores the challenges of string matching, focusing on exact and approximate methods. It covers the fundamental problem definition, including data structures for both patterns and text, such as suffix trees. The discussion includes algorithms based on edit distance, highlighting three error types: mismatches, insertions, and deletions. Specifically, it emphasizes dynamic programming methods for sequence alignment and K-approximate string searching. By providing examples and insights, this resource aims to clarify the intricacies of string matching in computational contexts.

1 / 27

Télécharger la présentation

String Matching

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. String Matching String matching: definition of the problem (text,pattern) depends on what we have: text or patterns • Exact matching: • The patterns ---> Data structures for the patterns • 1 pattern ---> The algorithm depends on |p| and || • k patterns ---> The algorithm depends on k, |p| and || • Extensions • Regular Expressions • The text ----> Data structure for the text (suffix tree, ...) • Approximate matching: • Dynamic programming • Sequence alignment (pairwise and multiple) • Sequence assembly: hash algorithm • Probabilistic search: Hidden Markov Models

  2. Approximate string matching For instance, given the sequence CTACTACTTACGTGACTAATACTGATCGTAGCTAC… search for the pattern ACTGA allowing one error… … but what is the meaning of “one error”?

  3. Edit distance Indel We accept three types of errors: 1. Mismatch: ACCGTGAT ACCGAGAT 2. Insertion: ACCGTGAT ACCGATGAT 3. Deletion: ACCGTGAT ACCGGAT The edit distance d between two strings is the minimum number of substitutions,insertions and deletions needed to transform the first string into the second one d(ACT,ACT)= d(ACT,AC)= d(ACT,C)= d(ACT,)= d(AC,ATC)= d(ACTTG,ATCTG)=

  4. Edit distance Indel We accept three types of errors: 1. Mismatch: ACCGTGAT ACCGAGAT 2. Insertion: ACCGTGAT ACCGATGAT 3. Deletion: ACCGTGAT ACCGGAT The edit distance d between two strings is the minimum number of substitutions,insertions and deletions needed to transform the first string into the second one d(ACT,ACT)= d(ACT,AC)= d(ACT,C)= d(ACT,)= d(AC,ATC)= d(ACTTG,ATCTG)= 0 1 2 3 1 2

  5. Edit distance and alignment of strings The Edit distance is related with the best alignment of strings Given d(ACT,ACT)=0 d(ACT,AC)=1 d(ACTTG,ATCTG)=2 which is the best alignment in every case? • ACT and ACT : ACT • ACT • ACT and AT: ACT • A -T • ACTTG and ATCTG: ACTTG ATCTG ACT - TG A - TCTG Then, the alignment suggest the substitutions, insertions and deletions to transform one string into the other

  6. Edit distance and alignment of strings But which is the distance between the strings ACGCTATGCTATACG and ACGGTAGTGACGC? … and the best alignment between them? 1966 was the first time this problem was discussed… and the algorithm was proposed in 1968,1970,… using the technique called “Dynamic programming”

  7. Edit distance and alignment of strings C T A C T A C T A C G T A C T G A

  8. Edit distance and alignment of strings C T A C T A C T A C G T A C T G A

  9. Edit distance and alignment of strings C T A C T A C T A C G T A C T G A The cell contains the distance between AC and CTACT.

  10. Edit distance and alignment of strings C T A C T A C T A C G T A C T G A ?

  11. Edit distance and alignment of strings C T A C T A C T A C G T 0 A C T G A ?

  12. Edit distance and alignment of strings C T A C T A C T A C G T 0 1 A C T G A ? - C

  13. Edit distance and alignment of strings C T A C T A C T A C G T 0 1 2 A C T G A ? - - CT

  14. Edit distance and alignment of strings C T A C T A C T A C G T 0 1 2 3 4 5 6 7 8 … A C T G A - - - - - - CTACTA

  15. Edit distance and alignment of strings C T A C T A C T A C G T 0 1 2 3 4 5 6 7 8 … A ? C ? T ? G A

  16. Edit distance and alignment of strings C T A C T A C T A C G T 0 1 2 3 4 5 6 7 8 … A 1 C 2 T 3 G… A ACT - - -

  17. Edit distance and alignment of strings - C C C C - BA(AC,CTA) BA(A,CTA) BA(A,CTAC) C T A C T A C T A C G T 0 1 2 3 4 5 6 7 8 … A 1 C 2 T 3 G A C T A C T A C T A C G T A C T G A d(AC,CTA)+1 d(A,CTA) BA(AC,CTAC)= best d(AC,CTAC)=min d(A,CTAC)+1

  18. Edit distance and alignment of strings Connect to http://alggen.lsi.upc.es/docencia/ember/leed/Tfc1.htm and use the global method.

  19. Edit distance and alignment of strings How this algorithm can be applied to the approximate search? to the K-approximate string searching?

  20. K-approximate string searching C T A C T A C T A C G T A C T G G T G A A … A C T G A This cell …

  21. K-approximate string searching C T A C T A C T A C G T A C T G G T G A A … A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters

  22. K-approximate string searching C T A C T A C T A C G T A C T G G T G A A … A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters

  23. K-approximate string searching * * * * * * C T A C G T A C T G G T G A A … A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters… …no matter where they appears in the text, then…

  24. K-approximate string searching * * * * * * C T A C G T A C T G G T G A A … 0 A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters… …no matter where they appears in the text, then…

  25. K-approximate string searching * * * * * * C T A C G T A C T G G T G A A … 0 A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters… …no matter where they appears in the text, then…

  26. K-approximate string searching C T A C T A C T A C G T A C T G G T G A A … 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 A C T G A This cell gives the distance between (ACTGA, CT…GTA)… …but we only are interested in the last characters… …no matter where they appears in the text, then

  27. K-approximate string searching Connect to http://alggen.lsi.upc.es/docencia/ember/leed/Tfc1.htm and use the semi-global method.

More Related