1 / 38

GENE

GENE. EXPRESSION. Spark Starter. Where does the mRNA travel to after it is synthesized in the nucleus? What molecule does the mRNA bind to at this site?. Today’s Task. Review Transcription Translation mRNA provides the code for Amino acids Amino Acids are the building blocks of proteins.

flavia-pittman
Télécharger la présentation

GENE

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GENE EXPRESSION

  2. Spark Starter • Where does the mRNA travel to after it is synthesized in the nucleus? • What molecule does the mRNA bind to at this site?

  3. Today’s Task.. • Review Transcription • Translation • mRNA provides the code for Amino acids • Amino Acids are the building blocks of proteins

  4. Video…

  5. Transcription Recap… 1. RNA polymerase unwinds DNA 2. RNA polymerase adds RNA nucleotides (A ↔ U, G ↔ C) 3. mRNA is formed! DNA reforms a double helix

  6. Transcription recap… • RNA polymerase makes mRNA using DNA sequence • mRNA leaves the nucleus for the cytoplasm

  7. Translation TRANSLATION: process of “decoding” a strand of mRNA to create proteins To Accomplish this the cell uses 2 special molecules: the Ribosome (rRNA) and the tRNA Ribosome tRNA

  8. Translation To a ribosome! • Ribosomes translate mRNA into an amino acid sequence • Amino acids form proteins

  9. Let’s Break It Down! Translation—process of “decoding” a strand of mRNA to create proteins Step 1: Reading the Codon Step 2: Matching the Codon with the anticodon Step 3: Elongation

  10. Step 1: Reading the Codon 1st mRNA binds to the Ribosome 2nd Ribosome reads the codon on mRNA Codons = 3 nucleotides in a row amino acid anticodon A C G

  11. Step 1: Reading the Codon Codons = 3 nucleotides in a row Box the Codon on your paper… AUGACGGAGCUUCGGAGCUAGGAUUAC CACAUGGAGGAUUACCUGCUAGCUAGU ACGGGCUGCAUGAGCUUCGGGAGCUUC

  12. Let’s Break It Down! Translation—process of “decoding” a strand of mRNA to create proteins Step 1: Reading the Codon Step 2: Matching the Codon with the anticodon Step 3: Elongation

  13. Step 2: Matching the codon w/t the anticodon Ribosome reads the codonand matches it with its complementary 3 base sequence called the Anticodon amino acid The Anticodonis found on the tRNA (Transfer RNA) anticodon Anticodon = 3 nucleotides on one end of a tRNA Anticodons base pair with complementary bases on mRNA A C G

  14. Step 2: Matching the codon w/t the anticodon Transfer RNA (tRNA) Carries a unique amino acid that corresponds with its Anticodon Each tRNA with a different anticodon will carry a different amino acids amino acid anticodon A C G

  15. Step 2: Matching the codon w/t the anticodon Anticodon = 3 nucleotides on one end of a tRNA Create the Anticodon to the following codon AUGACGGAGCUUCGGAGCUAGGAUUAC CACAUGGAGGAUUACCUGCUAGCUAGU ACGGGCUGCAUGAGCUUCGGGAGCUUC

  16. Step 2: Matching the codon w/t the anticodon Anticodon = 3 nucleotides on one end of a tRNA Create the Anticodon to the following codon AUGACGGAGCUUCGGAGCUAGGAUUAC UACUGCCUCGAAGCCUCGAUCCUAAUG CACAUGGAGGAUUACCUGCUAGCUAGU GUGUACCUCCUAAUGGACGAUCGAUCA ACGGGCUGCAUGAGCUUCGGGAGCUUC UGCCCGACGUACUCGAAGCCCUCGAAG

  17. Let’s Break It Down! Translation—process of “decoding” a strand of mRNA to create proteins Step 1: Reading the Codon Step 2: Matching the Codon with the anticodon Step 3: Elongation

  18. Step 3: Elongation Transfer RNA (tRNA) The tRNA with its amino acid binds to the ribosome The ribosome then starts connecting amino acids together to form a protein amino acid anticodon A C G

  19. Step 3: Elongation Codon triplets code for 1 of 20 amino acids Genetics Code Chart

  20. Step 3: Elongation Anticodon = 3 nucleotides on one end of a tRNA Match the Codon with its corresponding amino acid using the Genetics Code chart AUGACGGAGCUUCGGAGCUAGGAUUAC CACAUGGAGGAUUACCUGCUAGCUAGU ACGGGCUGCAUGAGCUUCGGGAGCUUC

  21. Codons 1 “start” codon 3 “stop” codons

  22. Steps of Translation • mRNA attaches to ribosome mRNA

  23. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  24. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  25. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  26. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  27. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  28. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  29. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  30. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  31. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA mRNA

  32. Steps of Translation 2. tRNAs add amino acids based on how anticodons match to mRNA

  33. Steps of Translation 3. Protein is released from ribosomes! Protein chain Stop codon

  34. Steps of Translation 3. Protein is released from ribosomes! Protein chain

  35. Summary DNA (Transcription) RNA (Translation) PROTEIN

  36. Practice • DNA sequence: AAC TGA CTG ATT GCA TGC • What is the complementary DNA sequence? • What is the complementary RNA sequence? • DNA sequence: TAG CAT TGG GCA TCA CGA • What is the complementary DNA sequence? • What is the complementary RNA sequence? TTG ACT GAC TAA CGT ACG UUG ACU GAC UAA CGU ACG ATC GTA ACC CGT AGT GCT AUC GUA ACC CGU AGU GCU

  37. Practice Determine the amino acids for this strand of mRNA: AUG GCA AGU UCU UGA Met – Ala – Ser – Ser – STOP

  38. Practice Determine the amino acids for this strand of mRNA: UGU AGA GAU CUC UAA Cys – Arg – Asp – Leu – STOP

More Related