gamada
Uploaded by
2 SLIDES
264 VUES
20LIKES

Supplementary figure 2

DESCRIPTION

Supplementary figure 2. +/+ +/m. kb. 12. 8. M +/+ +/m m/m. 2 kb 540bp 387bp. a. b. c. d. Supplementary figure 2. Generation of Unc5b mutant mice

1 / 2

Télécharger la présentation

Supplementary figure 2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Supplementary figure 2 +/+ +/m kb 12 8 M +/+ +/m m/m 2 kb 540bp 387bp a. b. c. d. Supplementary figure 2. Generation of Unc5b mutant mice a. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain. b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’34. The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b. The following primers were used: Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG, Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

  2. Supplementary figure 2 % normalized expression level f. +/+ +/m m/m kb exons amplified: 0 50 100 9.49 5,6 7.46 6,7 4.40 8,9 9,10 2.37 Probe: exons 1-17 11,12 12,13 9.49 7.46 13,14 14,15 4.40 15,16 16,17 2.37 Probe: exons 5-17 +/+ +/m m/m 18S rRNA e. Supplementary figure 2 (continued). Generation of Unc5b mutant mice e. Northern blot analysis of total RNA from E10.5 embryos using the probes indicated. Wild-type transcripts were not detected in the mutant. +, wild-type allele; m, mutant allele. f. Real-time RT-PCR analysis of total RNA from E10.5 embryos. The coding regions amplified by different primer pairs are indicated on the left. Expression levels in wild-type are set to 100 percent. Expression levels in the mutants on average are less than 3 percent of wild-type for all coding regions 3’ to the site of gene targeting. +, wild-type allele; m, mutant allele. The following primer pairs were used: Unc5b: ACAGGCACTCCCTCCGGTGG/ATCGTCTATGTGAATGGAGG TTGCACCACCGTGTGCCCAG/TGCCATGCACTCGCGGCTGC ATCAGAGAACTCTAAACGAC/ACCGCTACCACCACAAAGAC CAAGGCCCAACAACCCGCAG/TGTCGGCGGAGTCCTGCAGG AGCCTGTTGGTACCAAATGG/TTCTGAAAGTGGGAGGGTGC ACTGGGAGGAGGTGGTGACC/AGCTGGTCCAGCAGGATGTG ACACACCTGTAGCACTGAAG/GTAGGTTGTGGTAACTGTCC TGGCCAAGTACCAGGAGATTC/TCCGTGGAGGCCAGGCTATG TTGGCCGAGACGCCTGCTGG/TATCTTGAAGGCATAGGGTC CAGAAGCTGTCCATGGACCG/TCATCCTGTTGCCGAGCTTC Transferrin receptor:TGGGAACAGGTCTTCTGTTG/TGCAGTCCAGCTGGCAAAGA.

More Related